ID: 1118120989

View in Genome Browser
Species Human (GRCh38)
Location 14:62842615-62842637
Sequence GCGTCTCTTGCTCAACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118120989 Original CRISPR GCGTCTCTTGCTCAACAAGC AGG Intronic
903327251 1:22576543-22576565 GCGTCTCAAGCTCAACACGGAGG + Exonic
907406320 1:54255632-54255654 CCTTCTTTTGCTCAAAAAGCTGG + Intronic
915193399 1:154170993-154171015 ACTACTCTTGCTCATCAAGCAGG - Intronic
917436795 1:175030211-175030233 GGGCCTCTTGTTCAAAAAGCAGG + Intergenic
922249126 1:223831085-223831107 GAGACTCTTTCTCAAAAAGCAGG + Intronic
922754502 1:228088084-228088106 GAGCCTCATGCTCATCAAGCAGG - Intronic
923033536 1:230268164-230268186 GGGTCTCATTCTCAGCAAGCTGG + Intronic
924486091 1:244486117-244486139 GGGTCTCTTGCTCAGAAAGCAGG + Intronic
1065404269 10:25345969-25345991 GCTCCTCATGCTCAAGAAGCAGG - Intronic
1068860520 10:61843056-61843078 GCCTCTCTTTGGCAACAAGCAGG - Intergenic
1071839297 10:89452565-89452587 GGGCCCCTTGCTCAAAAAGCAGG - Intronic
1084448518 11:69218375-69218397 TGGTCTCTTGCTCACCAGGCAGG - Intergenic
1087034584 11:93742893-93742915 GCGTCCCTTGTTCAAAAAGAAGG + Intronic
1087232771 11:95684796-95684818 GTGTCTGCTGCTCACCAAGCTGG - Intergenic
1092969684 12:13680891-13680913 GAGGCTCTTTCTCAACAAGCAGG - Intronic
1096273045 12:50181953-50181975 GCGTCTCTTGGCCAACCAGCAGG - Exonic
1107314001 13:39111451-39111473 AGGTCTCTTGCTCAAGCAGCTGG + Intergenic
1114529270 14:23385569-23385591 GCATCTCTTGCAAACCAAGCTGG - Intronic
1114694591 14:24614580-24614602 GAGTCTTTTGTTCAACAAACAGG + Intergenic
1118120989 14:62842615-62842637 GCGTCTCTTGCTCAACAAGCAGG + Intronic
1120019372 14:79510940-79510962 GAGTCTCTTGCTCAACAGCTGGG - Intronic
1122843366 14:104477339-104477361 GCGGCTCTTGCTCCACAGGCGGG - Intronic
1125380982 15:39086324-39086346 GCATCTCTTTCTCAATAAGTTGG + Intergenic
1142143052 16:88481105-88481127 CCGTCTCCTGCTCATTAAGCCGG - Intronic
1142215829 16:88829378-88829400 GCTTCTCCTGCACAACAAGGCGG + Intronic
1157922628 18:51729078-51729100 GCGTCTTTTGCACAATAGGCGGG - Intergenic
1163142834 19:15362061-15362083 GCGTCTCTTGCCCATCCCGCAGG - Intronic
1164785037 19:30923734-30923756 GCCTCTCTTTCTCGAGAAGCTGG + Intergenic
1165667260 19:37643197-37643219 GTGTCTCCTCCTCAACCAGCAGG + Intronic
928263018 2:29784848-29784870 GCATCTCTTGCTAAACAACAGGG - Intronic
930675753 2:54198474-54198496 GGGGCTCTTGTTCAAAAAGCAGG + Intronic
938887712 2:135670022-135670044 GCTTCTCTTGCCCAAGGAGCTGG - Intronic
1171462714 20:25308040-25308062 GCGTCTCTAGATAAACAAACAGG + Exonic
1178698286 21:34812893-34812915 GAAACTCTTGCTCAACAAGAGGG + Intronic
1180900859 22:19371069-19371091 GAGTGTCTTCCTCAATAAGCAGG + Intronic
1180909876 22:19442393-19442415 GCATACCTTGCTAAACAAGCAGG + Exonic
1183842322 22:40509530-40509552 GCTTCTCTTTCTCATCCAGCTGG + Intronic
953557402 3:43957336-43957358 GCCCCTCTTTCACAACAAGCTGG - Intergenic
953704498 3:45220904-45220926 GGGACTCTGGCTCAACAAGGTGG - Intergenic
954334581 3:49908916-49908938 GCCTCTCTTGCCCAGCCAGCGGG - Exonic
956082835 3:65578051-65578073 CCGTCAGTCGCTCAACAAGCAGG - Intronic
963673143 3:148278000-148278022 GGGTCCCTTGTTCAAAAAGCAGG + Intergenic
972585460 4:40433391-40433413 GGGTCTCTTCCACAACAGGCAGG - Intronic
976690327 4:87861904-87861926 GCATCTCTTGTTCAAAAAGCAGG + Intergenic
982079012 4:151769136-151769158 GAGTCTCTTGTACAACAAGAGGG - Intergenic
995854251 5:116575832-116575854 GCGGCTCTTGCTCCCCAAGGGGG + Intergenic
997198785 5:131997298-131997320 GCCTCGCTTGCTGAACAAGGTGG - Intronic
1007943693 6:45805976-45805998 GAGTCTCTTCCACAACATGCGGG + Intergenic
1015437005 6:133200962-133200984 GGATCCCTTGCTCAAAAAGCAGG + Intergenic
1019729454 7:2622354-2622376 GCGTCTCTTGGCCAACAGCCAGG - Intergenic
1029273488 7:99391012-99391034 GCGTCTGTTTCTCAGCCAGCGGG + Exonic
1029647219 7:101865235-101865257 GCATCTGTAGCTCAACAAACCGG - Intronic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1030303319 7:107995743-107995765 GCCTCCCTTGCTGAACAGGCAGG - Intronic
1032336962 7:131034220-131034242 GTGTCTGTTGGTCAGCAAGCGGG - Intergenic
1033024609 7:137760360-137760382 GCTTTGCTTGCTAAACAAGCTGG + Intronic
1033397670 7:140991342-140991364 TTGTCTCTAGCACAACAAGCGGG - Intergenic
1036561808 8:9904981-9905003 GCGTCTCCTTCTCAAGATGCGGG - Intergenic
1042048174 8:64678208-64678230 GGATCTCCTTCTCAACAAGCAGG - Intronic
1046371398 8:113313184-113313206 GCGTAGATTGCTCAAAAAGCTGG + Intronic
1048889082 8:138931882-138931904 GGGTGTCTTGTTCAAAAAGCAGG + Intergenic
1050241681 9:3643000-3643022 GGGCCCCTTGCTCAAAAAGCAGG - Intergenic
1055410589 9:76025063-76025085 GCCTCTTTTGCACAAGAAGCAGG + Intronic
1056658894 9:88530613-88530635 GTGCCCCTTGTTCAACAAGCAGG + Intergenic
1056857037 9:90140474-90140496 GGGTCCCTTGCTCAAGAAGCAGG - Intergenic
1058617296 9:106844900-106844922 ACGTTTCTTGGTCAACAAGCAGG - Intergenic
1060720256 9:125971896-125971918 GTGTCTCTTTCTCATCATGCTGG + Intergenic
1061205869 9:129162909-129162931 GGGCCCCTTGCTCAAAAAGCAGG + Intergenic
1061363687 9:130159188-130159210 GCATCTGTCTCTCAACAAGCAGG + Intergenic
1187726752 X:22211251-22211273 GGGTCTCTTGTTCCAAAAGCAGG + Intronic
1195618684 X:106932440-106932462 GCCTTTCTTGCTCAACCAGCTGG - Intronic