ID: 1118125117

View in Genome Browser
Species Human (GRCh38)
Location 14:62893260-62893282
Sequence GAGTAACTGCAGATGTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118125108_1118125117 19 Left 1118125108 14:62893218-62893240 CCCTCATGGATGACTTTGAGGGG 0: 127
1: 350
2: 455
3: 457
4: 396
Right 1118125117 14:62893260-62893282 GAGTAACTGCAGATGTGGTGGGG 0: 1
1: 0
2: 2
3: 23
4: 169
1118125110_1118125117 18 Left 1118125110 14:62893219-62893241 CCTCATGGATGACTTTGAGGGGT 0: 118
1: 378
2: 484
3: 490
4: 414
Right 1118125117 14:62893260-62893282 GAGTAACTGCAGATGTGGTGGGG 0: 1
1: 0
2: 2
3: 23
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118125117 Original CRISPR GAGTAACTGCAGATGTGGTG GGG Intronic
902108068 1:14054436-14054458 GAGTAAATGAAGATGAGATGAGG + Intergenic
905147361 1:35897603-35897625 GCTTGACTGCAGGTGTGGTGTGG + Intronic
907300767 1:53485163-53485185 GAGAAGCTGCAGAAGGGGTGGGG + Intergenic
907754358 1:57296138-57296160 GAGTAAATGCAGATATTGTTGGG + Intronic
913203781 1:116517261-116517283 AAGTAGCTGGAGATGAGGTGAGG - Intronic
915601547 1:156925641-156925663 GGGTAACTACAGGTGTGGTTGGG + Intronic
919199290 1:194332641-194332663 GAGAAACTGCAGATCTTGGGTGG + Intergenic
921709297 1:218357284-218357306 GAGTAACTGCAGAGGGTTTGAGG + Intronic
922014440 1:221630837-221630859 GATTACCTGAAGATTTGGTGTGG + Intergenic
922038389 1:221872137-221872159 GAGTCACTGAAGATCTGATGGGG + Intergenic
922695763 1:227730165-227730187 GAGGAGCTGCAGATGTGCGGTGG - Intronic
1062965282 10:1602362-1602384 GAGGAATTGCTGATGTGGGGAGG - Intronic
1065597601 10:27330535-27330557 GAATAATTGGAGATGGGGTGGGG - Intergenic
1067209830 10:44250900-44250922 GAGTATCTGGAGGTGGGGTGTGG + Intergenic
1067697823 10:48548349-48548371 GAGTAACCGTAAATGGGGTGGGG - Intronic
1067760267 10:49039621-49039643 GAGGACTTGCAGATGAGGTGTGG + Intronic
1069782984 10:70968498-70968520 GAGTAACTGGAGAAGGGGTGAGG + Intergenic
1070604148 10:77886711-77886733 GAGGAACTGCAGAAGGGGTTAGG - Intronic
1074364015 10:112843878-112843900 AATTAACTGGAGATGGGGTGGGG - Intergenic
1074701786 10:116098678-116098700 GAGAAACAGGAGATGTGGAGAGG - Intronic
1074920131 10:117999711-117999733 GAGTAACTGCAGCAGTCATGTGG - Intergenic
1076862368 10:133144597-133144619 GCGTAACTCCAGACATGGTGGGG - Intergenic
1079978362 11:27121543-27121565 GAGTGACAGCAGTGGTGGTGTGG + Intronic
1080123953 11:28709456-28709478 AAGTAACTTCAGAAGTGGGGAGG - Intergenic
1080622275 11:33996767-33996789 GAGAAACAGCAGATCCGGTGCGG - Intergenic
1083148542 11:60775824-60775846 GAGTATGTGTAGATGTGGTGAGG - Exonic
1085347907 11:75780079-75780101 GAGAGAGTGCAGATGTGGTGAGG + Intronic
1085945393 11:81265060-81265082 AATTAACTGAAGTTGTGGTGGGG - Intergenic
1086141238 11:83502865-83502887 GAGTAACTTCAGAAGTACTGGGG - Intronic
1087076813 11:94133343-94133365 GGGTCACTGCAGAAGTGATGTGG + Intronic
1087351372 11:97037023-97037045 AAGTATTTGCAAATGTGGTGTGG - Intergenic
1088037799 11:105338534-105338556 AAGAAACAACAGATGTGGTGAGG + Intergenic
1088497977 11:110451429-110451451 AAGAAACAACAGATGTGGTGAGG + Intronic
1089830545 11:121323878-121323900 CAGCAACTTCAGATTTGGTGCGG + Intergenic
1098394824 12:70006322-70006344 GAGTAGCAGCAGCTGTGCTGTGG - Intergenic
1098597947 12:72295106-72295128 GGGTGACTGCAGCTGTGGTGGGG + Intronic
1099597626 12:84687914-84687936 AAGGAATTGCAGATGTTGTGGGG - Intergenic
1104426605 12:128683089-128683111 GAGAAACTGCACGCGTGGTGCGG + Intronic
1107213372 13:37885930-37885952 GAGAAAGGGCAGATGTGGAGCGG - Intergenic
1108244000 13:48497012-48497034 GTGTGACTGCAGTAGTGGTGGGG - Intronic
1110460360 13:75738213-75738235 GAGTAATGGAAGATGGGGTGTGG - Intronic
1113370693 13:109722431-109722453 GTATGAGTGCAGATGTGGTGGGG + Intergenic
1113712940 13:112482317-112482339 AAGGAACTGCAGATGTTGTGGGG - Intergenic
1115402480 14:32978097-32978119 GAGGAAGTGAAGATGTGGGGGGG + Intronic
1115578480 14:34734644-34734666 AAGTAACGGCAGGTATGGTGTGG - Intergenic
1117072740 14:52070506-52070528 GAGTAACTTCAGATGATGTTGGG - Intergenic
1118125117 14:62893260-62893282 GAGTAACTGCAGATGTGGTGGGG + Intronic
1121108161 14:91294117-91294139 GAGGATGTGCAGCTGTGGTGAGG + Intronic
1122481306 14:102049256-102049278 GAGCTAGAGCAGATGTGGTGAGG + Intronic
1125738142 15:41942825-41942847 GAGTAAATGAAGATGAGGAGTGG - Intronic
1125921353 15:43527641-43527663 GGGGAACTGCAGGTGGGGTGAGG - Exonic
1128702667 15:69815585-69815607 GAGAAAGTGCAGAGGGGGTGAGG + Intergenic
1131366262 15:91844521-91844543 GAGTAAGTGCATATGCGCTGGGG - Intergenic
1131373358 15:91903193-91903215 GAGTAACTGAAGATGCGAGGAGG + Intronic
1131389053 15:92032479-92032501 GAGTCAGTGCAGGGGTGGTGAGG + Intronic
1133762942 16:8814279-8814301 GAGTAACTGAAAAGGTGATGGGG - Intronic
1137332959 16:47518095-47518117 TAGGAACTGAAGATGTGGTAGGG - Intronic
1137794613 16:51205069-51205091 TAATATCTGCAGATGTGGTGAGG - Intergenic
1140450703 16:75068723-75068745 GCGTGGCTGCAGAAGTGGTGAGG - Intronic
1141324008 16:83038581-83038603 GAGAAACAGCAGATTTGGTGGGG - Intronic
1141578414 16:84980806-84980828 CAGTGACTGCATATGGGGTGAGG - Intronic
1141888165 16:86907422-86907444 CAGTGAATGCAGAGGTGGTGTGG + Intergenic
1144539562 17:16126884-16126906 GAGAAACTCCTGATATGGTGGGG - Intronic
1145965699 17:28915383-28915405 GAGGAAGAGCAGATGTGGAGAGG + Intronic
1147861546 17:43526976-43526998 TAGAAACTGCAGCTGTGCTGAGG - Intronic
1150379162 17:64707270-64707292 AAGTGACTGCAGACGTGGAGTGG + Intergenic
1152315847 17:79579831-79579853 GAGTCACTGGTGCTGTGGTGGGG + Intergenic
1152459384 17:80433243-80433265 CAGTACCTGCCCATGTGGTGGGG + Intronic
1153063200 18:1015063-1015085 GACTCACTGCAGATGTGGAAAGG + Intergenic
1153230450 18:2930504-2930526 GAGGAACTGAAGGTGTGATGTGG - Intronic
1153618421 18:6954464-6954486 GAGAAACTGCAGGAGTGGGGAGG + Intronic
1158540885 18:58353230-58353252 GAGTAACTGCAGAACTGATCAGG - Intronic
1161236440 19:3200741-3200763 GAGTGACTGCTGATGGGGAGGGG - Intronic
1162868263 19:13565638-13565660 GAGAATTTGCACATGTGGTGGGG - Intronic
1163677800 19:18664038-18664060 GAGTGACTGCTGATGGGGTGGGG - Intronic
1163686164 19:18712983-18713005 GAGTAACTGCTGATGGGGATAGG - Intronic
1167447908 19:49549663-49549685 TAGTGACTGCTGATGGGGTGTGG - Intergenic
1167526128 19:49984912-49984934 GAATAGCAGCAGATCTGGTGCGG - Intronic
925299699 2:2802455-2802477 AAATCACTGCAGATGTGGTAGGG - Intergenic
925925984 2:8670977-8670999 GGGAACCTGAAGATGTGGTGAGG + Intergenic
926137349 2:10346236-10346258 CAGTGACTGCTGATGTTGTGGGG + Intronic
927108667 2:19848834-19848856 GAGTAAATGAAGATATGGTGGGG - Intergenic
927662057 2:25001510-25001532 GTGTAGCTGCAGCTGTGGGGTGG + Intergenic
928607222 2:32953961-32953983 GAGGAGCTGCCGATGGGGTGGGG + Intronic
928886212 2:36151538-36151560 GAGGAACAGCAGATGGGCTGAGG + Intergenic
929774876 2:44923274-44923296 GAGTGGCTGCAGATGTGACGTGG + Intergenic
930182879 2:48382525-48382547 GAGAAACTGGGGCTGTGGTGGGG + Intergenic
932001627 2:67890455-67890477 GAGTGTCTGCAGATATGTTGAGG - Intergenic
934533237 2:95110022-95110044 CAGTGACTGCAGATGAGCTGTGG - Exonic
934550583 2:95259014-95259036 GAATAACTGGATATGTGGCGAGG + Intronic
935526072 2:104169115-104169137 GATTAACTGGAGATAGGGTGGGG - Intergenic
936726426 2:115323378-115323400 AAATAACTGCAGATGTGGTAGGG - Intronic
936785162 2:116086239-116086261 GAGTAAGTGCAGATGTGGGGTGG + Intergenic
938383607 2:130850012-130850034 CTGTAACTGCACATGTGGTCTGG + Intronic
939981536 2:148788149-148788171 GAGTAACTCCAGAGGTAGTATGG - Intergenic
941296759 2:163748619-163748641 GAGTAACTTCAGATCTGATTAGG - Intergenic
941750611 2:169131605-169131627 GAGTGAGTGCACATGTGTTGGGG + Intronic
942088972 2:172469944-172469966 GAGTAAATGGAGATGTAGAGAGG + Intronic
942691549 2:178590549-178590571 GAGAAACAGCTGATTTGGTGTGG - Exonic
942910349 2:181236167-181236189 GAGGAACTGAAGATTGGGTGGGG - Intergenic
943945713 2:194060568-194060590 CATTAAATGCAGAGGTGGTGAGG + Intergenic
945432232 2:209777587-209777609 GAGTGGGTGGAGATGTGGTGAGG + Intronic
1170710378 20:18785487-18785509 GGGAAACTGCAGATGTGTGGGGG - Intergenic
1172221138 20:33275950-33275972 GAGAGACTGGAGATGGGGTGGGG + Intronic
1173141467 20:40488565-40488587 GAGTCACTTCAAATGTGCTGAGG + Intergenic
1173253632 20:41377490-41377512 GAGTACCTGCAGGTGTGGCGGGG + Intergenic
1173500377 20:43548686-43548708 GAGTAAATACATTTGTGGTGGGG - Intronic
1174860171 20:54084024-54084046 GAGTAAGGGAAAATGTGGTGTGG + Intergenic
1178690172 21:34743956-34743978 GAGTAACTGCAGACAGGGTGTGG + Intergenic
1181854799 22:25774209-25774231 GAGTGACTGAAGGTGTGGTGTGG - Intronic
1182446899 22:30395006-30395028 GGGTAACTTCAGATGCGGGGAGG + Intronic
1183682472 22:39341098-39341120 AAGTAACTGCAGGCCTGGTGTGG - Intergenic
1183978996 22:41528753-41528775 GAGTGACTGTGGTTGTGGTGGGG + Exonic
1184145996 22:42611005-42611027 AAGTCACTGGAGATGTGCTGTGG + Intronic
951957210 3:28270407-28270429 AAGAAACAACAGATGTGGTGAGG - Intronic
952152610 3:30608272-30608294 CAGTATCTGCAGCTGTGGTCTGG + Intronic
956061432 3:65351995-65352017 GAGTCTCTGCACATTTGGTGTGG + Intergenic
956555697 3:70520368-70520390 GAGTAACTGCAGTTTTGGTTTGG - Intergenic
960636967 3:119793716-119793738 GGGTCTCTGCAGATGTGATGAGG - Intronic
961098706 3:124180086-124180108 GGGTAACTGCTTGTGTGGTGGGG + Intronic
962440517 3:135410952-135410974 TAGAAACTGCAGATGTGAAGGGG - Intergenic
962942012 3:140133606-140133628 GAATAATTGCAGAGGTGGGGGGG + Intronic
966203021 3:177377218-177377240 AAGCAACTGCAGAGGTGGTGTGG + Intergenic
972815421 4:42639811-42639833 GAGCATCTGCAGATTTGGTAAGG - Intronic
975681718 4:76884051-76884073 GAGTAGCTGCAAATGGGGGGTGG - Intergenic
975707481 4:77125374-77125396 AAATAACTGCATATGTGATGTGG - Intergenic
978546176 4:109874794-109874816 TAGTCACTGCAGATATGATGGGG - Intergenic
980089122 4:128423473-128423495 GAGTTATTTCAGATGTGGGGTGG - Intergenic
980169021 4:129264440-129264462 GAGTAACTCAGGATGTGGAGTGG - Intergenic
981857922 4:149317322-149317344 GAGTATGTGCATGTGTGGTGGGG - Intergenic
985511439 5:316227-316249 GAGAAGCTGCAGGTGTGGGGTGG - Intronic
986331952 5:6723712-6723734 GATTAGATTCAGATGTGGTGGGG + Intronic
988797130 5:34661770-34661792 CTGTTACTGCAGATGTCGTGTGG - Intronic
994456805 5:100019762-100019784 GAGTAACTCAAGATATGGTGGGG - Intergenic
995220987 5:109647581-109647603 AAGTCACTGCAGATGTGATAAGG + Intergenic
997198775 5:131997238-131997260 GAGTACCTGCAGCTGTTGTGAGG - Intronic
1001099919 5:168805835-168805857 GAGTACCTGCCCATGTGCTGAGG + Intronic
1002075832 5:176707869-176707891 TAGTTCCTGCAGATCTGGTGGGG - Intergenic
1003689024 6:8334026-8334048 GAGTGACTGCTGATGAGATGGGG - Intergenic
1006670160 6:35725436-35725458 GAGAAACTCCAGACCTGGTGTGG + Intronic
1008959747 6:57254403-57254425 GAGTAGGTGAAGTTGTGGTGAGG - Intergenic
1009219846 6:60970394-60970416 GAGGAAATGGAGATGTGGAGAGG - Intergenic
1010612110 6:77965248-77965270 GAAGAACTAGAGATGTGGTGTGG - Intergenic
1013306736 6:108854654-108854676 GAGATGCTGCAGATGTGTTGTGG - Intronic
1013740896 6:113283428-113283450 AAGTAACAACAGATGTTGTGAGG + Intergenic
1014151920 6:118067219-118067241 GAGGAACTGCAGATTTGTTGGGG + Intronic
1016354059 6:143198693-143198715 GCTTAAATGCAGACGTGGTGTGG - Intronic
1016641292 6:146352445-146352467 GAGTATCTGGAGAGGAGGTGTGG + Exonic
1017960911 6:159219471-159219493 CAATAACTGCAGATGAGGAGGGG - Intronic
1018921972 6:168181647-168181669 GAGCACCTGCACAGGTGGTGAGG + Intergenic
1019112496 6:169727290-169727312 GAGTATCTGGAGAGGTGGTAGGG + Intergenic
1019116476 6:169767819-169767841 GTGTATGTGCATATGTGGTGTGG - Intronic
1019175486 6:170157311-170157333 GAGGGGCTGCAGATGTGGGGTGG - Intergenic
1019735507 7:2648127-2648149 TAGGATCTGCAGATGAGGTGGGG - Intronic
1021281978 7:18731204-18731226 GAGAAACTGCAGATGGGGGAGGG + Intronic
1023032417 7:36101998-36102020 GAATACCTGGAGATGTGGGGAGG + Intergenic
1023679604 7:42672008-42672030 GTGAAACTGCAGAGGTGGAGAGG - Intergenic
1024019942 7:45359629-45359651 GAGTGGTTGCAGATGTGGTGGGG + Intergenic
1024179458 7:46876064-46876086 GAGTGACTGCTAATGGGGTGTGG - Intergenic
1024502478 7:50125967-50125989 GTGTATGTGCATATGTGGTGAGG - Intronic
1028451450 7:90989395-90989417 GAGTAACTGCTGAAGTAGTATGG - Intronic
1032456187 7:132075211-132075233 AACTAACTGCAGAGGTGATGGGG + Intergenic
1033435465 7:141329656-141329678 TAGCCACTGCAGATGTGTTGGGG + Intronic
1034005801 7:147470774-147470796 ACCTAACTGCAGATGAGGTGGGG + Intronic
1034762857 7:153689820-153689842 GAGTAGCTGCTGAAATGGTGAGG + Intergenic
1035165268 7:156985643-156985665 GGAGAACTCCAGATGTGGTGAGG + Intergenic
1035324953 7:158059525-158059547 GTGTCACTGCAGATGGAGTGTGG - Intronic
1036027633 8:4927941-4927963 GAATCACTGGAGATGTAGTGTGG - Intronic
1038298244 8:26316684-26316706 AGGCAACTGCAGATCTGGTGAGG + Intronic
1038563687 8:28601708-28601730 GAGGAAATGCAGCTGGGGTGTGG - Intronic
1039129731 8:34249408-34249430 GAGAAACTGGAGATGGGGTGGGG + Intergenic
1041009956 8:53531954-53531976 GAATAACTACAGTTGTTGTGGGG + Intergenic
1044360254 8:91275001-91275023 GAGTACCTGCAGATGTTGAATGG - Intronic
1045675150 8:104599249-104599271 GAATAACTTCAAATGTGGTATGG + Intronic
1045788112 8:105948126-105948148 GAGTAACTGAGGATATGGTGGGG - Intergenic
1045880235 8:107029794-107029816 AAGTACCTGAAGATGTGGAGTGG + Intergenic
1047748658 8:127864130-127864152 GAGAAGCTGCAGGTGGGGTGTGG + Intergenic
1051551990 9:18340034-18340056 GAGTAACATCAGATGTGAAGTGG - Intergenic
1051745532 9:20291613-20291635 GAGCAAATGCACAAGTGGTGGGG - Intergenic
1051797709 9:20892518-20892540 AAGTCACTGCAGATGTGGGAGGG + Intronic
1052412564 9:28141318-28141340 GAATATTTGCAAATGTGGTGTGG + Intronic
1057240420 9:93403198-93403220 AAGTCACTGCAGATGTGGTGGGG + Intergenic
1060084860 9:120688680-120688702 GAGTAACTACATGTGTGTTGTGG + Intronic
1060556641 9:124511413-124511435 GACTGACTGCAGGTGTGGAGTGG - Intergenic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1062541074 9:137041809-137041831 GAGTGACTTCAGGTGTGGTGAGG - Intronic
1190842737 X:54161117-54161139 GAGTAACTCCAGATGTGTCAGGG + Intronic
1194301199 X:92188142-92188164 GAGTAACTGGGGAAGTGATGAGG + Intronic
1194949981 X:100114183-100114205 GAGTAAATGTATGTGTGGTGAGG + Intergenic
1196291498 X:113946947-113946969 GAGTAACTGCTGATATAGTTTGG - Intergenic
1196508517 X:116477397-116477419 GAGAAACTGCAGAAGTTGTGAGG - Intergenic
1196734522 X:118972908-118972930 GAGAAACTCCAGATGTAGTCAGG - Intergenic
1199888541 X:152049490-152049512 GAATAACAGGAGATGTGATGTGG - Intergenic
1200043208 X:153384766-153384788 GAGTGACTGCCGATGTGGACAGG + Intergenic
1200103586 X:153700463-153700485 GTGTGACTGCAGCTGTGGGGAGG - Intergenic