ID: 1118130834

View in Genome Browser
Species Human (GRCh38)
Location 14:62961555-62961577
Sequence AAGACTGAAGTGGCCATGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118130829_1118130834 29 Left 1118130829 14:62961503-62961525 CCAAGAAATGCTGAGGGAATGAG 0: 1
1: 0
2: 2
3: 35
4: 309
Right 1118130834 14:62961555-62961577 AAGACTGAAGTGGCCATGATGGG 0: 1
1: 0
2: 0
3: 13
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118130834 Original CRISPR AAGACTGAAGTGGCCATGAT GGG Intronic
901652095 1:10748904-10748926 CAGACTGACGTGGCGATGTTAGG - Intronic
901849052 1:12003797-12003819 AAGACTGAAGAGTGCATGGTTGG + Intronic
901925910 1:12565857-12565879 GAGGCTGCAGTGGCCATGATCGG + Intergenic
904274652 1:29372486-29372508 AAGAGAGAATTGGCCATAATGGG + Intergenic
904487675 1:30838184-30838206 AAGACTTAAGAGGACATGAAAGG + Intergenic
907011372 1:50966786-50966808 ACCACTGAAGTAGCCATCATGGG + Intronic
907092641 1:51742126-51742148 AACACTGAGCTGGCCCTGATGGG + Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
909483758 1:76152051-76152073 AAGACTAAAGAGCCCATGGTGGG - Intronic
910626193 1:89310566-89310588 AAGATAGAAGGGGCCATGTTTGG + Intergenic
911248590 1:95548636-95548658 TAAACTTAAGTAGCCATGATGGG - Intergenic
914442917 1:147722729-147722751 AGGATTGAAGTGGGGATGATGGG + Intergenic
914463077 1:147902687-147902709 ATGACTGGATTGGCCCTGATGGG - Intergenic
917199470 1:172499783-172499805 AAGACTGATGTGGCAGTGTTTGG - Intergenic
917891728 1:179445522-179445544 AGGACTGAAGTGACGATGTTGGG - Intronic
921398866 1:214698273-214698295 AAGAGTTAAGTGGCCAGGAACGG + Intergenic
923850550 1:237789802-237789824 TAGACGGATGTGGCCATGACTGG - Intronic
1063729737 10:8682569-8682591 AAAACTGAAGTGGACTTCATAGG + Intergenic
1064345996 10:14533382-14533404 AAGGCTCAAGTTGCCATGACGGG + Intronic
1065313845 10:24442621-24442643 AAGAATGGAGGGGCTATGATAGG + Intronic
1067260764 10:44689239-44689261 AGGTCTGAAATGGCAATGATTGG - Intergenic
1067582082 10:47452357-47452379 GAGACTGAAGTGGGCATGAGGGG - Intergenic
1068222454 10:54061603-54061625 TAGACTGAGGTGGCCAGGTTAGG - Intronic
1069012104 10:63385963-63385985 AAGACTTAAGTTTCCATGTTTGG - Intronic
1069852515 10:71419278-71419300 AAGAATGAAGTGACCTTGAGGGG + Intronic
1070953709 10:80450922-80450944 AAGAAGGCAGGGGCCATGATAGG - Intergenic
1073138345 10:101231752-101231774 AAGACTGAAGAGGACAGGAAGGG - Intergenic
1073203398 10:101754361-101754383 ATGAATGAAGTTGCCATTATGGG - Intergenic
1076983367 11:217600-217622 CATAATGAAGTGACCATGATTGG + Intronic
1080030726 11:27658083-27658105 AAGACTGCAGTGGACATGTCGGG - Exonic
1081228004 11:40548675-40548697 AAGAACGAGGGGGCCATGATTGG + Intronic
1082217478 11:49590673-49590695 AATACTAAAGTGGACATGAGTGG + Intergenic
1083222162 11:61259467-61259489 AAGACTGAAGGAGCCATGAACGG + Intronic
1086632092 11:89033481-89033503 AATACTAAAGTGGACATGAGTGG - Intronic
1087173299 11:95073113-95073135 AAGACTGAAATGACCAAGATGGG - Intergenic
1087404113 11:97708302-97708324 TAGACTGAATTCACCATGATTGG - Intergenic
1089584959 11:119504471-119504493 AGGACTGCAGAGCCCATGATGGG + Intergenic
1092369841 12:7907656-7907678 AAGACTGATGTGGCCAGGAGTGG - Intergenic
1094390265 12:29941411-29941433 TAGACTGACTTGGCCATCATAGG + Intergenic
1095159110 12:38895234-38895256 AAGAATGAATTTGCCATGAAGGG + Intronic
1095984389 12:47989814-47989836 AAGAAGGAAGTGACCATGAGAGG + Intronic
1096185369 12:49576982-49577004 AAGCCTGAACTGGGCATCATAGG - Intronic
1096656190 12:53093884-53093906 AAGGCTGACGTGGGCCTGATGGG - Intergenic
1099079325 12:78156800-78156822 TAAACTGAAGTGACCATCATGGG + Intronic
1099473217 12:83075756-83075778 AAGACAGATGTGGGCAGGATGGG - Intronic
1100949998 12:99837132-99837154 AAGACTCAACTGGCCATTGTTGG + Intronic
1102307559 12:111817105-111817127 TATTCTGAAGTGGCCATGCTTGG + Intergenic
1104209653 12:126676542-126676564 AATATTGAATTGGCCATAATTGG + Intergenic
1104578530 12:129990869-129990891 AAGACATGAGTGGCCATGTTGGG + Intergenic
1105784428 13:23734654-23734676 AAGACTGACGTGTCCATGTGTGG - Intronic
1106646382 13:31638690-31638712 AATACTGAAGAAGCCAAGATGGG + Intergenic
1109268172 13:60224589-60224611 AAGACTGGAGTGGCCAGGTGCGG - Intergenic
1111842609 13:93469538-93469560 CAGATTGGAGTGGCCATGATAGG + Intronic
1112909640 13:104465242-104465264 GAGACTGAAATGGACATGAAAGG - Intergenic
1115489506 14:33945515-33945537 AAGGCTGAGGTGGCCATTGTGGG + Intronic
1116063076 14:39948527-39948549 AAGAATGAGGTGGGGATGATGGG - Intergenic
1117334724 14:54747336-54747358 AAGACTTAGGTGGGGATGATGGG - Intronic
1118130834 14:62961555-62961577 AAGACTGAAGTGGCCATGATGGG + Intronic
1118806489 14:69241647-69241669 TAGACTGAAGTGACCCAGATGGG - Exonic
1122515583 14:102306115-102306137 AAGACTGAATTGGCCAGGTGTGG + Intergenic
1123112300 14:105878716-105878738 CAGGCTGGAGTGGCCATGGTAGG + Intergenic
1124571820 15:30871347-30871369 AAAACTGACGCTGCCATGATGGG - Intergenic
1126210293 15:46093870-46093892 AAGACTGGAGTGGCAATCAAAGG - Intergenic
1128499062 15:68214500-68214522 AAGAATTAAGTGTACATGATGGG - Intronic
1128559433 15:68655001-68655023 ATGACTGAGGTGGCCATGCCAGG + Intronic
1128845416 15:70890709-70890731 AAGACTTAATTGGCAATGATGGG + Intronic
1133311701 16:4851756-4851778 GAGGCTGAAGTGGCTGTGATTGG + Intronic
1134352446 16:13450448-13450470 AAAGTTGAAGTGGCCATGAATGG - Intergenic
1134876785 16:17707531-17707553 AAGATTGGAGTAGTCATGATTGG + Intergenic
1135829645 16:25762054-25762076 AAGAGTGGAGTCCCCATGATAGG + Intronic
1136288697 16:29259000-29259022 AAGTCTGAAGGTGCCGTGATGGG + Intergenic
1137376328 16:47955230-47955252 AAAACTGAAGAGGCCATGGAAGG - Intergenic
1140443701 16:75006724-75006746 AAGACTGAGGTGGCCAGGCACGG - Intronic
1140702316 16:77592365-77592387 AAAACATAAGTGGCTATGATGGG - Intergenic
1140784166 16:78324089-78324111 AAGCTTGAAGTGGCAAGGATGGG + Intronic
1142544927 17:694122-694144 AAGACAGATGGGGCCATGACAGG + Intronic
1145759698 17:27419208-27419230 AAGGTTGAAGGGCCCATGATGGG - Intergenic
1145799348 17:27673128-27673150 AAGGGTGAAGGGCCCATGATGGG + Intergenic
1146159666 17:30553144-30553166 AAGGGTGAAGGGCCCATGATGGG - Intergenic
1146844717 17:36175362-36175384 AAGGGTGAAGGGCCCATGATGGG + Intronic
1146857023 17:36263297-36263319 AAGGGTGAAGGGCCCATGATGGG + Intronic
1146863594 17:36325078-36325100 AAGGGTGAAGGGCCCATGATGGG - Intronic
1146872933 17:36387207-36387229 AAGGGTGAAGGGCCCATGATGGG + Intronic
1146880291 17:36438293-36438315 AAGGGTGAAGGGCCCATGATGGG + Intronic
1147066454 17:37925666-37925688 AAGGGTGAAGGGCCCATGATGGG - Intronic
1147075817 17:37987832-37987854 AAGGGTGAAGGGCCCATGATGGG + Intronic
1147077986 17:38005227-38005249 AAGGGTGAAGGGCCCATGATGGG - Intronic
1147087342 17:38067378-38067400 AAGGGTGAAGGGCCCATGATGGG + Intronic
1147093922 17:38129162-38129184 AAGGGTGAAGGGCCCATGATGGG - Intergenic
1147103286 17:38191341-38191363 AAGGGTGAAGGGCCCATGATGGG + Intergenic
1149642498 17:58212857-58212879 AAGTCAGAAGGGGCCATGAAGGG + Intronic
1149744978 17:59087832-59087854 AAGAGTGATGTGGCAGTGATTGG - Intronic
1149847861 17:60017810-60017832 AAGGGTGAAGGGCCCATGATGGG + Intergenic
1150086217 17:62274427-62274449 AAGGGTGAAGGGCCCATGATGGG + Intronic
1152385424 17:79971400-79971422 AAGACTGAAGTGTGCAGAATCGG + Intronic
1203195550 17_KI270729v1_random:228119-228141 TAGAATGAAGTGGACATGAACGG + Intergenic
1203205028 17_KI270730v1_random:28511-28533 TAGAATGAAGTGGACATGAACGG + Intergenic
1153535389 18:6096673-6096695 AAGACTGAAGTGGACAGGCTAGG + Intronic
1153723830 18:7936062-7936084 AAGACAGAGATGGCCATGGTTGG + Intronic
1156989408 18:43389264-43389286 CAAACTGAAGGGGCCAAGATGGG + Intergenic
1157150822 18:45216159-45216181 AAGATTGAATTGGCCTTGATTGG - Intronic
1164894500 19:31860627-31860649 AAGGCTGAAGAGGCCATCAAGGG - Intergenic
1165996816 19:39849457-39849479 GAGAGTGGTGTGGCCATGATTGG - Intergenic
1166805107 19:45481746-45481768 AAGACTGAAACGGCCTTTATTGG - Intergenic
1167052102 19:47085565-47085587 AAGACTGCAGTGGGAAGGATTGG - Intronic
925104907 2:1282984-1283006 AAGACAGAAGTGGCCACGGAAGG + Intronic
927022783 2:19034845-19034867 AAGGCTGACGTTGACATGATGGG + Intergenic
927425491 2:22976883-22976905 AAGAATGAGGGGGCCATGAGTGG - Intergenic
927436064 2:23067664-23067686 AGGACTGAAATGCCAATGATGGG + Intergenic
929950160 2:46403884-46403906 AAAAATGATGTGGCCATGAAAGG - Intergenic
931533177 2:63240422-63240444 AAGACTCAAGAGGCCAAGGTGGG - Intronic
936614464 2:114034312-114034334 AATGCTGAAGTGGCTATGTTAGG + Intergenic
937839541 2:126511628-126511650 AAGCCTGAAGTGGGCCTGCTTGG - Intergenic
939583099 2:143974905-143974927 AAGACTTAAGTTGTCTTGATTGG - Intronic
939685044 2:145188875-145188897 AAAAGTGAAGTGGCCATGTTAGG + Intergenic
940075667 2:149739269-149739291 AAGACTGAAATGGCCATTGGGGG - Intergenic
942089934 2:172480129-172480151 AAAACTGCAGTGGCCAACATGGG + Intronic
943116714 2:183681404-183681426 AAGACTCAGGTGGCCAGGAACGG - Intergenic
943160089 2:184236852-184236874 AAGACTCAACTGGCCATTATTGG - Intergenic
945181015 2:207091158-207091180 AAGACTGAAGTGGACGTCTTTGG + Intronic
945458416 2:210075605-210075627 AACTCTGAAGTGGCCTTGTTCGG + Exonic
945725733 2:213470679-213470701 ATGAGAAAAGTGGCCATGATGGG - Intronic
946950626 2:224870798-224870820 AAAAATGGAGTGGCCATGAATGG - Intronic
1172210081 20:33191240-33191262 AAGACTGATGTGGCCAATGTGGG + Intergenic
1173650130 20:44658306-44658328 AAGACAGAAGTGGCCAGGCGTGG - Intergenic
1175133057 20:56803959-56803981 AAGGCTGAACTGGTTATGATTGG - Intergenic
1177853769 21:26378758-26378780 TAGAATGAAGTGGCAATGGTAGG - Intergenic
1179073257 21:38093146-38093168 TAGACTGAGGTTGACATGATTGG + Intronic
1179158602 21:38873634-38873656 AAGCCTGCAGTGGGCCTGATGGG - Intergenic
1185180331 22:49356534-49356556 AAGCCTGAATTGACCAGGATAGG - Intergenic
952443714 3:33359773-33359795 ATGACTTAAGTGGCCAAGCTAGG - Intronic
954354135 3:50070773-50070795 AGGGCTGGAGTAGCCATGATCGG + Intronic
955636655 3:61037258-61037280 AAGACTGGAGTGGTTATGCTTGG + Intronic
957015330 3:75056435-75056457 AAGACTGCAGTAGCCACGACTGG + Intergenic
957128830 3:76197918-76197940 AAAACTGCAGTGGTCATCATAGG - Intronic
959482007 3:106885271-106885293 AAGAATGAAGTGGTCAAGAGAGG + Intergenic
961289319 3:125832844-125832866 AGGAGGGAAGTGGCCCTGATAGG + Intergenic
961611393 3:128142718-128142740 AAGACTCAACTGGCCATTTTTGG - Intronic
962492378 3:135907084-135907106 GAGACAGAAGTGGCCAGGAGTGG + Intergenic
967173034 3:186838829-186838851 AAGACTGAAGTGGGGAAGAAGGG + Intergenic
968261112 3:197324822-197324844 AAGGCAGAAGGGGCCAGGATTGG + Intergenic
968851310 4:3081047-3081069 AAGATTGATTTGGCCATGCTGGG + Intronic
969937209 4:10694127-10694149 AAGACTGACGTGGCAATTGTAGG - Intergenic
971134416 4:23852480-23852502 ATGAGTGATGTGGCCTTGATGGG - Intronic
971253206 4:24990625-24990647 AAGACAGAAGTGGCCAGGTGTGG + Intergenic
974404319 4:61446282-61446304 AAGTCTGAAGTGGAAATGAAGGG - Intronic
974424168 4:61719650-61719672 TAGAGTGCAGTGGCCATGCTTGG + Intronic
975062537 4:70020191-70020213 AAGACTCAAGTGGCCATTGCTGG - Intergenic
975202524 4:71608076-71608098 AGGACTGAAGTGTCCAGGAAAGG + Intergenic
980198784 4:129626843-129626865 AAGCCTGAATTGGCCATGGAGGG - Intergenic
986373792 5:7109447-7109469 AAGACTGAGGTGCCCAGGTTGGG - Intergenic
986739210 5:10691146-10691168 AAAACTGAAAAGGCCATAATTGG + Intronic
989654095 5:43725833-43725855 AAAACTTAAGAGGCCATTATAGG + Intergenic
991001482 5:61787931-61787953 AAGACTGAAGAGGCAATTAATGG + Intergenic
992085357 5:73273505-73273527 AGGAATGAAGTGGCAGTGATGGG + Intergenic
992742360 5:79786414-79786436 ACGACTGATGTGACTATGATTGG - Intronic
992885354 5:81153403-81153425 AAGACTGGAGTGGCCATAGCTGG + Intronic
995663659 5:114515627-114515649 ATGTCTGAAGAGGTCATGATAGG - Intergenic
995980890 5:118102787-118102809 AAGACTGTATTTGCAATGATAGG - Intergenic
996607406 5:125339992-125340014 AAGACTGAACATGCCAGGATGGG - Intergenic
997426320 5:133805093-133805115 AAGACTGAGGAGGCCAAGAGAGG - Intergenic
999101107 5:149027071-149027093 AAGGCTCAGGTGGCCAAGATTGG + Exonic
999427233 5:151498832-151498854 CTGACTGAACTGGCCAGGATGGG - Intergenic
999922227 5:156334297-156334319 ACCATAGAAGTGGCCATGATGGG + Intronic
1002096245 5:176832876-176832898 AGGACTGACGAGGCCATGACAGG + Intronic
1003241900 6:4352450-4352472 AATTCTGTAGTGGCCATGCTGGG + Intergenic
1006561241 6:34914569-34914591 AATACTGAGTTGGCCAGGATGGG + Intronic
1006632061 6:35436733-35436755 CAGACGGCAGTGGCCATGGTGGG + Intergenic
1006912230 6:37570931-37570953 AAGAGTGAAGGGGTCAGGATAGG + Intergenic
1010295201 6:74187659-74187681 AAGACTGAAATGTCCAGAATCGG + Intergenic
1010932195 6:81816762-81816784 AAAACTGAAATGACAATGATAGG - Intergenic
1012471437 6:99576696-99576718 AAGACTCAACTGGCCATGGCTGG - Intergenic
1012779746 6:103542706-103542728 AAGACTGAAGTAGAAATGAGAGG - Intergenic
1014454100 6:121616871-121616893 AAGTCTGAATTTGACATGATAGG + Intergenic
1014847576 6:126297445-126297467 CATACTAAAGTGTCCATGATGGG - Intergenic
1015330511 6:131973410-131973432 AAGACTTCAGTTTCCATGATGGG + Intergenic
1016852699 6:148637333-148637355 AATACTGAAGTGTCTTTGATGGG - Intergenic
1020450565 7:8316338-8316360 CAGACTGCAGTGGGGATGATGGG - Intergenic
1020983244 7:15097981-15098003 ATGACTGAAATTGCCATCATAGG + Intergenic
1021027813 7:15689625-15689647 AACACTGAAGTAGCTATTATAGG - Intergenic
1022611597 7:31880296-31880318 AAGACTGAAGAGGGAATGCTGGG + Intronic
1026664777 7:72332827-72332849 AAGGCTGATGAGGCCATGGTGGG - Intronic
1027875558 7:83763459-83763481 AAGAATAAAGAGGCCATCATTGG + Intergenic
1030743508 7:113137881-113137903 AAGACTGAAGAGGCATTGCTGGG - Intergenic
1030921113 7:115389069-115389091 AATACTGTAGTGGCCATGCGAGG + Intergenic
1030975988 7:116123755-116123777 AAGAAGGAAGTGAACATGATAGG - Intronic
1032437486 7:131912018-131912040 AAGACTGCAGTTGTCACGATTGG + Intergenic
1034298411 7:149994242-149994264 AAGAATGAAGTGGCCATCGAAGG + Intergenic
1034807603 7:154102540-154102562 AAGAATGAAGTGGCCATTGAAGG - Intronic
1041669520 8:60478635-60478657 AAGACTGAAATGGCCAGCCTTGG + Intergenic
1047131978 8:122031335-122031357 AAGACTCAAATGGCTATGAAAGG - Intergenic
1048246928 8:132814988-132815010 AAAACTCAAGTGGATATGATAGG + Intronic
1048389831 8:133952204-133952226 AAGGCTGAACTGGCCAGGAGAGG + Intergenic
1051055305 9:12978229-12978251 AAGACTGAAGTGGTCAGGTGAGG - Intergenic
1052070745 9:24078839-24078861 AGGACAGAAGTGGCCAGCATGGG + Intergenic
1052864661 9:33457671-33457693 AGGACTGAAGAGGCCAAGGTTGG - Intergenic
1056201694 9:84283148-84283170 TACACAGATGTGGCCATGATGGG + Intronic
1056454428 9:86746296-86746318 CATACTGAAGGGGCCTTGATGGG - Intergenic
1057687438 9:97248139-97248161 AGGACTGTACTGGCCATTATGGG - Intergenic
1058840491 9:108902846-108902868 CAGACCGAATTGGCCATGATTGG - Exonic
1059533041 9:115055447-115055469 AAGAGTGAAGAAGCCATAATAGG + Intronic
1186103332 X:6179850-6179872 AAGACTCATGTGGCTATGATGGG + Intronic
1186535609 X:10344021-10344043 AAGCCTGAAGTGGACAGGACTGG + Intergenic
1187109640 X:16283560-16283582 AAGTCCAGAGTGGCCATGATGGG - Intergenic
1187966924 X:24620938-24620960 GAGGCTGAGGAGGCCATGATGGG - Intronic
1195241929 X:102960606-102960628 GAGGCTGGAGTGGCCATGCTAGG + Intergenic
1195868833 X:109464306-109464328 AAGCCTTCAGTGGCTATGATTGG + Intronic
1195970850 X:110471579-110471601 AAGGCTGAGGTACCCATGATAGG - Intergenic
1198594255 X:138218976-138218998 AAGAATGGAGTGGCTATGAAGGG + Intergenic