ID: 1118132692

View in Genome Browser
Species Human (GRCh38)
Location 14:62985048-62985070
Sequence CTTGATTTGCAGAAAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 335}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118132690_1118132692 -8 Left 1118132690 14:62985033-62985055 CCTCCTACATTTCAGCTTGATTT 0: 1
1: 0
2: 2
3: 61
4: 1537
Right 1118132692 14:62985048-62985070 CTTGATTTGCAGAAAGAAACAGG 0: 1
1: 0
2: 3
3: 29
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118132692 Original CRISPR CTTGATTTGCAGAAAGAAAC AGG Intronic
901678891 1:10901933-10901955 CTTGTTTTCCAGAAAAAAACAGG + Intergenic
902113293 1:14100685-14100707 CTAGACTTCCAGAAAGAAACAGG + Intergenic
906338694 1:44958364-44958386 CTTGATTTCTAGATAGAAGCTGG + Intronic
907014797 1:51002225-51002247 TTTGATTTTGAGAAAGAAAAAGG + Intergenic
907588293 1:55641232-55641254 CTTGCTTTACAGGAGGAAACGGG + Intergenic
908047494 1:60186061-60186083 CTTTATTTACAGTAAGAACCTGG - Intergenic
908092299 1:60698982-60699004 CTTGATTTGCAAAAGGAACCAGG + Intergenic
908649765 1:66319338-66319360 CTTTATTTGTAGAATGAAAATGG - Intronic
910438141 1:87226348-87226370 GATTATTTCCAGAAAGAAACTGG + Intergenic
910754569 1:90673836-90673858 GTTGATAGCCAGAAAGAAACTGG - Intergenic
912331762 1:108826650-108826672 CTTCATTTTCAGCTAGAAACAGG + Intronic
913185667 1:116368676-116368698 GTTGATTTGCAGAAAACAATTGG + Intergenic
913531604 1:119737739-119737761 CTTGATTTGGGGAAAGCAAGGGG - Intronic
913553429 1:119939093-119939115 TTTGAGTTGTGGAAAGAAACTGG + Intronic
916519899 1:165554281-165554303 GTGGGTTTGCAGAAACAAACAGG + Intronic
917254621 1:173100974-173100996 GTTGATTGGGAGAAAGGAACAGG + Intergenic
917478172 1:175386604-175386626 CATGACCTCCAGAAAGAAACAGG - Intronic
919106549 1:193159224-193159246 CTTAATTTGCTGTAACAAACAGG - Intronic
919532056 1:198734403-198734425 CTCGATGTGAAGAAGGAAACAGG + Exonic
919597049 1:199577361-199577383 GTTGATATGTAGAAAGAACCAGG + Intergenic
921098705 1:211909982-211910004 CTTCAGTTGCACAAAGAAACAGG + Intergenic
921682913 1:218055351-218055373 CTAGGTTTCCATAAAGAAACTGG - Intergenic
922966406 1:229694537-229694559 CTTAATTTGCAGCAGGAAGCGGG + Intergenic
923325978 1:232880515-232880537 TTTCAGTTGCAGCAAGAAACAGG - Intergenic
923429565 1:233906850-233906872 AATTATTTGCAGGAAGAAACAGG + Intronic
923474724 1:234321728-234321750 CTTGATTGGAAGAGAGAAGCCGG + Intronic
923505370 1:234600598-234600620 CTTGATTTGTATAAAGATAATGG + Intergenic
1063521979 10:6749325-6749347 CTTGATTTGCAAGAAGAACATGG - Intergenic
1064198461 10:13264633-13264655 CTTGTTTTGGAGGAAGACACAGG + Intergenic
1065083729 10:22153179-22153201 CACCATTTGCAGAATGAAACTGG + Intergenic
1065195721 10:23263613-23263635 TTTGATCTGCAGAAAGAATCAGG - Intergenic
1065208607 10:23381092-23381114 TTCGATTTTCAGCAAGAAACGGG - Intergenic
1065297953 10:24294406-24294428 CTTGATGATCATAAAGAAACTGG - Intronic
1065932430 10:30491477-30491499 TTTGCTGTGCAGGAAGAAACTGG + Intergenic
1065999785 10:31093417-31093439 CTTGAGTTACAGGAGGAAACAGG - Intergenic
1066192168 10:33066137-33066159 CTTTATTTGCAAAAACAATCTGG - Intergenic
1066714980 10:38277064-38277086 CTTGATGTACAGAAAAAAATGGG + Intergenic
1067004224 10:42645971-42645993 CTGGATCTGGAGACAGAAACTGG + Intergenic
1067382534 10:45788055-45788077 TTTGTTTTGCACAAGGAAACAGG - Intronic
1067890237 10:50128603-50128625 TTTGTTTTGCACAAGGAAACAGG - Intronic
1068188988 10:53625435-53625457 CCTGAGTTGCATCAAGAAACAGG - Intergenic
1068581166 10:58741267-58741289 ATTGATTTGCAGAAGGAGAAGGG + Intronic
1068782151 10:60931737-60931759 CTTGAGTCAGAGAAAGAAACAGG - Intronic
1069022515 10:63504715-63504737 CTTGCTATGCAGATTGAAACAGG + Intergenic
1069061621 10:63900818-63900840 GTTGATGTGCAGAAATACACGGG - Intergenic
1069616031 10:69806607-69806629 CTTGCTGTGAAGAAAGAAGCTGG + Intronic
1069888723 10:71639651-71639673 CTTTTCTTGGAGAAAGAAACTGG - Intronic
1070192928 10:74129026-74129048 CTCAACTTTCAGAAAGAAACAGG + Intronic
1070504877 10:77104335-77104357 CTTGAATTGGAGCAAGAGACGGG + Intronic
1072289581 10:93951873-93951895 CTAGTTTTACAGCAAGAAACTGG + Intronic
1072704022 10:97667049-97667071 CTTCTTTTGCAGAAAGATCCTGG + Exonic
1072858931 10:98982523-98982545 CTTGATATGAAGGAAGAATCAGG + Intronic
1073224124 10:101902146-101902168 AATTATTTGCAGAAAGAAATAGG - Intronic
1073690897 10:105808484-105808506 CTTGATGTGAATGAAGAAACAGG - Intergenic
1073725423 10:106224624-106224646 CTGCTTTTGCAGAAAGAAATAGG - Intergenic
1075888973 10:125929162-125929184 TTTGAGCTGCAGAAAGAAACAGG + Intronic
1079122162 11:17693922-17693944 CTTCATTTCCAGAAAGAATAAGG + Intergenic
1079158729 11:17973429-17973451 CTTGGTTTCCAAAGAGAAACTGG + Intronic
1082006672 11:47423086-47423108 CTTGATATGGGGAAAGAAATGGG - Intronic
1082228478 11:49736416-49736438 CTTGATTCACAGAAATAAGCAGG + Intergenic
1083604404 11:63969277-63969299 CCTGAGCTACAGAAAGAAACAGG - Intergenic
1084525750 11:69697065-69697087 CTTGATTGGCAGATGGAGACAGG + Intergenic
1084602329 11:70153338-70153360 CTTTATTTGCAAAAACAGACAGG + Intronic
1086621592 11:88892732-88892754 CTTGATTCACAGAAATAAGCAGG - Intronic
1086721522 11:90127548-90127570 CTTTATTGGCAGCAAGAAAATGG - Intergenic
1088610348 11:111570619-111570641 TTTGTTTTCCAGAAAGAAACTGG + Intergenic
1092380672 12:7994275-7994297 CCTAATTTGCAGAAAGGCACTGG + Intergenic
1095532318 12:43202938-43202960 CTTGAAGTGCAGAAAGTAAGTGG + Intergenic
1096749604 12:53750460-53750482 CTGAATTTGCTGAGAGAAACTGG + Intergenic
1097464099 12:59901191-59901213 CTTGATTAGCAGCATGAAAATGG + Intergenic
1097981310 12:65740772-65740794 TTTGAACTGCAGAAAGAAAAAGG - Intergenic
1098630530 12:72716372-72716394 TTTGAGCTGCAGAAAGAAATAGG - Intergenic
1099514410 12:83579254-83579276 TTAGATTTGCAGATAAAAACTGG + Intergenic
1099948055 12:89267536-89267558 TTTCATTTGCAGAAAGTAAGTGG + Intergenic
1100608644 12:96172114-96172136 CTTGAGTGGCAGAAGGAACCTGG - Intergenic
1103038465 12:117675364-117675386 CCTGATTTGCAGATGGAGACTGG - Intronic
1103972541 12:124681081-124681103 CTTTATTTACAAAAACAAACAGG - Intergenic
1104322227 12:127762295-127762317 CTTGTTTCCCAGGAAGAAACAGG - Intergenic
1105954564 13:25268629-25268651 CTTGATCTGCAGGAAGAAAAGGG - Intronic
1107331391 13:39304842-39304864 CTATATTTGAGGAAAGAAACAGG - Intergenic
1108378620 13:49836606-49836628 CTGGACTTGCACAAAGGAACAGG - Intergenic
1109745274 13:66616528-66616550 GTTGCTTCACAGAAAGAAACAGG - Intronic
1110237369 13:73230776-73230798 CTTGATGTGAAGAAAGATTCAGG + Intergenic
1110639262 13:77803059-77803081 GTTGATATGGATAAAGAAACAGG + Intergenic
1110903611 13:80857118-80857140 TTTGATGTACTGAAAGAAACTGG + Intergenic
1111285145 13:86081258-86081280 CATGGTTTGGTGAAAGAAACAGG + Intergenic
1111945765 13:94663893-94663915 CTTGTTTTGCAAAAATAAAAAGG - Intergenic
1112029527 13:95444315-95444337 CTTGAATTGCAGAAGGCAGCAGG + Intronic
1113649701 13:112026944-112026966 CATGGTTTGCAGAAAGGAAACGG + Intergenic
1114865806 14:26595451-26595473 GTTCAGTTGCAAAAAGAAACTGG - Exonic
1115429122 14:33295885-33295907 CTTAACTTGCTGAAAGAGACAGG - Intronic
1116244732 14:42394941-42394963 CTAGATTTGAAGAAGCAAACTGG + Intergenic
1117572234 14:57058865-57058887 GTTTATTTGGAGAAAGAAATGGG - Intergenic
1117649308 14:57886395-57886417 ATTGATTTCCAGAAATAAAGTGG + Intronic
1118132692 14:62985048-62985070 CTTGATTTGCAGAAAGAAACAGG + Intronic
1119178677 14:72588785-72588807 TGTGATTTACAGAAAGAAATGGG + Intergenic
1119416024 14:74469891-74469913 ATTAATTTACAGAAATAAACAGG + Intergenic
1121577275 14:94998420-94998442 CTTGATTTGGAGAAGGAAGTAGG + Intergenic
1122446699 14:101774980-101775002 CTTGATTTACAAAAATAACCAGG + Intronic
1125047846 15:35263262-35263284 CTTTATATGGAGAAATAAACAGG + Intronic
1125289946 15:38135061-38135083 CTAGAGTTACAGTAAGAAACGGG + Intergenic
1127579502 15:60324514-60324536 CTTCCATTGCAGAAAGAAAGAGG - Intergenic
1127653545 15:61033472-61033494 ATGGATTTGGAGAAAGAAAATGG - Intronic
1127883770 15:63181064-63181086 CTTGAGTTTCAGAAAGCAATAGG + Intergenic
1128352728 15:66901875-66901897 CTTGAGCTGCAGAAGGAAGCAGG - Intergenic
1129518597 15:76171721-76171743 CTCCATTTGCAGAAAGTATCTGG + Intronic
1129678738 15:77646214-77646236 CTTGATGTGCAGCTAGACACAGG - Intronic
1131907443 15:97158578-97158600 GTTGATTAGGAGAAAGACACAGG + Intergenic
1136352150 16:29717745-29717767 CTTGATTTACAGGAATAAACAGG - Intergenic
1136856508 16:33662855-33662877 ATTCATTGGAAGAAAGAAACAGG + Intergenic
1138748157 16:59387667-59387689 CTTGATTTCAAGGAAGAAATAGG - Intergenic
1138858659 16:60727748-60727770 CTGGATTTGCTGAAATAAAAAGG - Intergenic
1139345045 16:66297357-66297379 TTTTATTTGTAGAAGGAAACAGG - Intergenic
1139426690 16:66884933-66884955 CTTGATTTGCACATGGAAATGGG + Exonic
1139673172 16:68505501-68505523 CTTGAGGTGCACAAAGAAAGAGG + Intergenic
1140917598 16:79508044-79508066 CTAGATTTGCAGCAGGAAAAAGG + Intergenic
1203118088 16_KI270728v1_random:1511332-1511354 ATTCATTGGAAGAAAGAAACAGG + Intergenic
1142525436 17:537105-537127 CTTGATGTGCAGAATGACAGAGG + Exonic
1144241437 17:13316486-13316508 CCTGATTTACTGAAAGAAACAGG + Intergenic
1145049982 17:19652117-19652139 CTTTATTTGAATGAAGAAACTGG - Intronic
1145279136 17:21455618-21455640 CTTGGATTGGAGAAAGGAACTGG + Intergenic
1145287441 17:21516796-21516818 CCTGAGTTACAGAAAGGAACAGG - Intergenic
1145390182 17:22449582-22449604 CCTGAGTTACAGAAAGGAACAGG + Intergenic
1145398723 17:22514829-22514851 CTTGGATTGGAGAAAGGAACTGG - Intergenic
1146253051 17:31367105-31367127 CTTGGTTTTCAGAAGGAATCTGG - Intronic
1149247246 17:54724678-54724700 CTTTATTAGCAAAAAAAAACTGG + Intergenic
1149936329 17:60810608-60810630 GTTGATTTGCAGAACGATGCAGG - Intronic
1150854874 17:68742663-68742685 CTTGATCTGCAGCAAGTATCTGG - Intergenic
1151074287 17:71253509-71253531 CTTTATTTCCAGGAAGAAACAGG - Intergenic
1151783444 17:76262942-76262964 CTTGATTTCCAGGAAATAACAGG + Intergenic
1153238368 18:3010016-3010038 CTTGATTTTCAGCAGGAAGCTGG - Intronic
1155510828 18:26575119-26575141 CTCCTGTTGCAGAAAGAAACAGG + Intronic
1156136246 18:34042322-34042344 CTTTACTTGCAGATAGAAAGGGG - Intronic
1156853668 18:41756802-41756824 ACTTATTGGCAGAAAGAAACAGG - Intergenic
1157436144 18:47671017-47671039 CTTGTTTTGTGGGAAGAAACTGG - Intergenic
1157667722 18:49501702-49501724 CTTCATTTCCAGCAAGAATCTGG + Intergenic
1158377863 18:56892520-56892542 CTTTATTTGCAAAAAAAAATGGG - Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1159670339 18:71213665-71213687 TTTGATTTGGGGAAAGAAATTGG + Intergenic
1159801224 18:72902072-72902094 ATTGATTTGGATAAATAAACGGG + Intergenic
1160604364 18:80038254-80038276 CCTGGTTTGCAGAACCAAACCGG - Intronic
1163125481 19:15242166-15242188 CTTGATTTGCAGGCAGCACCCGG + Intronic
926488423 2:13492373-13492395 TTTGATTTTCAGAAAAACACTGG + Intergenic
930418147 2:51116105-51116127 GTTGATATGTAGAAAGTAACAGG - Intergenic
930491036 2:52072528-52072550 CTTGACTTCCTGAAAGAAAATGG + Intergenic
930619102 2:53625839-53625861 TTTGGGTTGCAGAAATAAACAGG - Intronic
933407730 2:81882325-81882347 TTTCATTTGGAGAAACAAACTGG - Intergenic
934869157 2:97844760-97844782 CTTAATCTGCAGAAAGTAACAGG - Intronic
935378365 2:102423166-102423188 CTTGATTTACAGAAATGAAGGGG + Exonic
935651216 2:105383717-105383739 CTTTACTTCCAGAAAAAAACAGG + Intronic
936459067 2:112698131-112698153 TTCCATTTGCATAAAGAAACTGG - Intergenic
936551788 2:113449402-113449424 CTTGATTTAAAGTGAGAAACAGG + Intronic
936594467 2:113834790-113834812 TTTGTTTTACAGAAAAAAACAGG - Intergenic
937627613 2:124061048-124061070 CTTGATTTCCAGAAAAAAAACGG - Intronic
938234762 2:129696750-129696772 CTTTATTTGCAGAGTGAAAATGG + Intergenic
938316143 2:130330148-130330170 CTTGAGGGGAAGAAAGAAACTGG - Intergenic
938626488 2:133114697-133114719 CTTTATTTGTTGAAAAAAACAGG + Intronic
939873024 2:147546226-147546248 CCTGAATTCCAGAAACAAACAGG - Intergenic
940960496 2:159780072-159780094 CTTGATGTGCAGAAAAGCACAGG + Exonic
941014338 2:160337640-160337662 CTTCATTTTAAGAAAAAAACTGG + Intronic
941045328 2:160669026-160669048 CTAGATTTGCAGAAGCAAAATGG - Intergenic
941185010 2:162311308-162311330 CTAGATATACAGAAAGAAATTGG - Intronic
943759339 2:191591525-191591547 ATTGATTTGGAGGAAGAATCAGG - Intergenic
946175363 2:217919159-217919181 ATTGAGGTCCAGAAAGAAACAGG + Intronic
948161754 2:235830377-235830399 CTTGATTTGAAGAAAGACAGTGG - Intronic
948937098 2:241173666-241173688 CTGGGTTTTCAGAGAGAAACCGG - Intronic
1168785648 20:537791-537813 CTTGATTTGAAATGAGAAACTGG - Intronic
1170915662 20:20622252-20622274 CTGGAGATGCAGAAAAAAACAGG + Intronic
1172306416 20:33883954-33883976 TTACATTTGCATAAAGAAACTGG - Intergenic
1173421104 20:42901778-42901800 CCTGATTTGGAGAAAGACATTGG - Intronic
1174138426 20:48396499-48396521 CTTGATTGACAAAAAGCAACAGG + Intergenic
1174993771 20:55543029-55543051 CTGCATTTGCAGAAAGACAAGGG + Intergenic
1176662577 21:9652635-9652657 CTGGATTTTCAGAAATAAAAAGG + Intergenic
1177226894 21:18268590-18268612 CTTTATTAGCAGTAAGAAAATGG + Intergenic
1177936162 21:27348814-27348836 CTTGCTTTGCAAACAGAAATGGG - Intergenic
1178454006 21:32729810-32729832 TTTAATTTGAAGAAAGAAGCTGG - Intergenic
1178532141 21:33384644-33384666 ATTTGTTTCCAGAAAGAAACAGG + Intergenic
1178744380 21:35234091-35234113 ATTGATTTGCAGCAAGAAGAAGG - Intronic
1182019884 22:27072730-27072752 CATCATTTGCAGCAACAAACTGG - Intergenic
1183012544 22:34958762-34958784 CTTCATGTGCAGAGAGAAAGTGG + Intergenic
1184686515 22:46098811-46098833 CCTCAGTTGCAGAAAGAAAGAGG - Intronic
949096746 3:95433-95455 CTGGCTTTGCAGAAGGAAAGGGG - Intergenic
949520523 3:4848944-4848966 CTTTACTTGTAGAGAGAAACAGG - Intronic
949768152 3:7549987-7550009 TTGGATATGCAAAAAGAAACTGG - Intronic
950194617 3:11000311-11000333 TTTGGATTGTAGAAAGAAACTGG + Intronic
950617154 3:14169562-14169584 CTTGGTATGGAAAAAGAAACAGG + Intronic
951096457 3:18637413-18637435 CTTGGCTTGTGGAAAGAAACAGG + Intergenic
951170789 3:19539483-19539505 CTTTAATTACAGAAAGATACAGG + Intergenic
951577215 3:24126218-24126240 ATTGTTTTGTAGAGAGAAACAGG - Intronic
951966250 3:28388961-28388983 CCTGACTTCCAAAAAGAAACTGG - Intronic
952219263 3:31307944-31307966 TGTGATTTGCAGAAATAAAATGG - Intergenic
952766413 3:36957755-36957777 TTTGATTTTCTGATAGAAACTGG + Intergenic
953698833 3:45180593-45180615 CTTGAGTGGCAGAATGACACAGG - Intergenic
953799502 3:46011487-46011509 CTGGAGTTGCAGGAGGAAACTGG + Intergenic
954245451 3:49327907-49327929 AATTATTTACAGAAAGAAACAGG + Intronic
954671466 3:52293420-52293442 CTCGCTTCACAGAAAGAAACAGG - Exonic
956498691 3:69857359-69857381 TTTTATTTAAAGAAAGAAACTGG - Intronic
956581528 3:70819297-70819319 AAGGATCTGCAGAAAGAAACAGG - Intergenic
957508744 3:81159760-81159782 CTTGATTTGGAGACAGCAAGTGG - Intergenic
958033291 3:88140400-88140422 CTTGATTTGCTAGTAGAAACTGG - Exonic
959196578 3:103190632-103190654 AATGATTTTCATAAAGAAACAGG + Intergenic
959501842 3:107115784-107115806 CTTAATATTCAGAAAGGAACAGG + Intergenic
959750052 3:109823484-109823506 CATGATTTACAGAAATAAAGAGG + Intergenic
960245854 3:115399846-115399868 TTTGATTAGCAGAAAGAGCCAGG - Intergenic
960983183 3:123250831-123250853 TTTAATTTGCATAAAGAAACTGG + Intronic
961613723 3:128162179-128162201 CTGGATGGGCACAAAGAAACAGG - Intronic
963839498 3:150091155-150091177 CTGGATTTGCTGACAGAAAAGGG - Intergenic
963950793 3:151198255-151198277 CTTGACTTGCATTTAGAAACAGG + Exonic
965282125 3:166767283-166767305 CAAGATGTGCAGAATGAAACAGG - Intergenic
965324726 3:167289645-167289667 CTTGGTTTCCAGCACGAAACTGG + Intronic
965433442 3:168617726-168617748 CTTGGTTTGCATAAAGAAACTGG + Intergenic
967708017 3:192675048-192675070 CTTTAGGTGCAGAAAGAAAATGG + Intronic
969882107 4:10183196-10183218 CTTGATTTGCATATAGTAAAAGG - Intergenic
970032327 4:11690621-11690643 AATGGTTTGCAGAAAGAAGCAGG + Intergenic
970839678 4:20452745-20452767 CTTGATGGGCAGAAGGAAAATGG - Intronic
971882895 4:32404459-32404481 CTTTATTTTCAATAAGAAACTGG + Intergenic
971991166 4:33896614-33896636 CTTGCTTTGCAAATAGAATCTGG + Intergenic
972155349 4:36154443-36154465 TTTGATTTTCAAAAAGAAAGTGG - Intronic
975461932 4:74664046-74664068 TTTGAATTGGAGAGAGAAACTGG + Intergenic
975841469 4:78478950-78478972 TTTAATTCCCAGAAAGAAACAGG - Intronic
976179188 4:82383089-82383111 TTTGATTTAGAGAAATAAACTGG - Intergenic
977269603 4:94899997-94900019 CTAGATTTGCAGCAAGAGAGAGG + Intronic
978159847 4:105532831-105532853 ATTGATTGGGACAAAGAAACTGG + Intergenic
978220556 4:106268643-106268665 TTTTATTTACTGAAAGAAACAGG + Intronic
980712215 4:136584712-136584734 AGTGATTTGCTGAAAGAAATTGG - Intergenic
983441243 4:167788917-167788939 CTTTATTTGGAGAAATATACTGG + Intergenic
984509716 4:180664414-180664436 CTTAATTTGCAGACATAATCTGG + Intergenic
985412819 4:189703890-189703912 CTGGATTTTCAGAAATAAAAAGG - Intergenic
987140551 5:14941383-14941405 TTTGATTCGCAGAAAGCTACAGG + Intergenic
988012295 5:25505147-25505169 CTTTATCTGCAGTAAGAAAATGG - Intergenic
989126699 5:38060638-38060660 CTGGATTTGAAGAAAGAAAAGGG - Intergenic
989153371 5:38321466-38321488 CTTGAGTTGGTGACAGAAACAGG + Intronic
990760719 5:59126538-59126560 CTTCCTTTTCAAAAAGAAACAGG + Intronic
991045318 5:62217218-62217240 ATTCATTGGAAGAAAGAAACAGG - Intergenic
991562545 5:67969773-67969795 GTAGATTTGCAGGAAGAAACAGG - Intergenic
991956808 5:72002848-72002870 CCTCATTTACAGAATGAAACTGG - Intergenic
992348458 5:75904950-75904972 CTTGCTTTCCAGTAAGAAATAGG - Intergenic
993089305 5:83404445-83404467 CTTAATTTGGAAAAAGAGACAGG - Intergenic
993173336 5:84450081-84450103 CTTGGTTTAAAGAAAAAAACAGG - Intergenic
993554566 5:89319535-89319557 CTTGATTTGAATAAAGTATCAGG - Intergenic
993936653 5:94012934-94012956 AGTGATTGGTAGAAAGAAACGGG + Intronic
994150786 5:96445426-96445448 CTTGCTCTGCAGAAAAGAACTGG + Intergenic
994530877 5:100968795-100968817 CTTACTTTGAGGAAAGAAACTGG - Intergenic
995227495 5:109718106-109718128 CATGATTGGCAGAAAGAGAAGGG - Intronic
995519665 5:112990001-112990023 CTTATTTTTCAGGAAGAAACTGG - Intronic
996836550 5:127800010-127800032 ATTAATTTTCAGAAAGAAAATGG + Intergenic
997066688 5:130568426-130568448 CTTCATTTGAAAATAGAAACAGG + Intergenic
997299837 5:132795132-132795154 GTTTATTTGTTGAAAGAAACTGG - Intronic
997905672 5:137814545-137814567 CTTGATTTGGGCACAGAAACAGG - Intergenic
999433469 5:151543857-151543879 CCTGATTGCCAGAAAGAATCAGG + Exonic
999600502 5:153257980-153258002 TTTCTTTTGTAGAAAGAAACTGG - Intergenic
1000356618 5:160402578-160402600 CTTGGTTTTGAGAAAAAAACAGG - Exonic
1001412021 5:171518902-171518924 CTTGATCTTCATAAAGAAAATGG - Intergenic
1002058821 5:176614071-176614093 CTTGCTTTTCAGAAAGTCACTGG - Intergenic
1004814693 6:19300362-19300384 CTTGCTAGGCAGAAAGAAACAGG + Intergenic
1006770537 6:36548968-36548990 TTGGATTTGCAGACAGAAAATGG - Intergenic
1007453392 6:41957429-41957451 CTGGATTTGGAGAAAGAAGCAGG - Intronic
1008080170 6:47186273-47186295 CTGGCTTTGAAGAAAGAACCTGG + Intergenic
1009619444 6:66053944-66053966 TTTTATTTGCAGAAACAAAATGG - Intergenic
1010375937 6:75170119-75170141 TTTGCTTTTCAGAAAGAAAATGG - Intronic
1010801053 6:80176099-80176121 CTGGATTAGCAGAAGGAAATGGG + Intronic
1011010321 6:82696145-82696167 CTACATTTGCAGTAAGGAACAGG - Intergenic
1011106307 6:83785551-83785573 TTTGCTTTACAGAAAGAAAGTGG - Intergenic
1012259751 6:97073919-97073941 CTTGATGTGCAGCAGGAAAAAGG - Intronic
1012636990 6:101555390-101555412 CTTGATTTTCAGAAAACATCTGG + Intronic
1012893402 6:104922169-104922191 CTTGGTTTGAAGAGAGAGACAGG - Intergenic
1014009257 6:116458142-116458164 ATTGATTTGCAGAACGATGCGGG + Intergenic
1014170720 6:118276380-118276402 CTTGCTTTGTAGAAAGAGATTGG - Intronic
1014468639 6:121786831-121786853 CTAGATTTGCTGAAAGAGGCTGG - Intergenic
1014498561 6:122157808-122157830 CTTGATTTACAAAAGGGAACAGG - Intergenic
1015164601 6:130189524-130189546 CTTGAGTTGCTAACAGAAACGGG - Intronic
1015227386 6:130873181-130873203 CTTTTTTTGCAAAAAGAAACAGG + Intronic
1015506009 6:133989246-133989268 CTTGATTTTCAAAAATAAAAAGG - Exonic
1015737307 6:136414491-136414513 TTTGTTTTGCTGAAAGAAAATGG + Intronic
1016675008 6:146754775-146754797 CTTGATTTGAATCAGGAAACTGG - Intronic
1016718825 6:147268763-147268785 CTTGCTTTAAACAAAGAAACTGG + Intronic
1017398064 6:154027305-154027327 TTTGTTTTGGAGAAAGTAACAGG - Intronic
1017589660 6:155965204-155965226 CAGTTTTTGCAGAAAGAAACTGG + Intergenic
1018227486 6:161642502-161642524 TTTGATTTCCAGAATGAAAGAGG - Intronic
1018299045 6:162380576-162380598 TTTGCTTTGCACAAAGACACAGG + Intronic
1020701319 7:11487542-11487564 CTTGATTAGCAGCATGAAAATGG - Intronic
1020721915 7:11756099-11756121 CTTTATTTGCAGAATGTACCAGG + Intronic
1021361712 7:19722396-19722418 ATTGAGTTGAAGAAAGAAAGAGG - Intronic
1021840157 7:24715887-24715909 CTTCATTTGCAGAATGAGAGAGG + Intronic
1022414059 7:30163236-30163258 ATTCATTTGGAGAAAGAAACTGG - Intergenic
1022879858 7:34575381-34575403 CGTGATTTACAAAAAGAAAGAGG - Intergenic
1023008797 7:35906537-35906559 CTTAATTAGCAGAAAGACAGTGG - Exonic
1023016734 7:35975957-35975979 CTTTATTAGCAGAAAGACAGTGG - Intergenic
1023530217 7:41145689-41145711 TTTGAGATGCAGAATGAAACTGG - Intergenic
1023553979 7:41400582-41400604 ATTGAGTTGCAGATAGAAACAGG - Intergenic
1023650636 7:42365258-42365280 CTTTATTAGCAGAATGAAAAGGG - Intergenic
1024170496 7:46780258-46780280 CATGGTTTGCATAAATAAACAGG - Intergenic
1024190134 7:46997708-46997730 ACTGATTGGCAGAAAGAATCAGG + Intergenic
1028394016 7:90347646-90347668 CTTGATTTAGTGAAGGAAACAGG + Intronic
1028774601 7:94663322-94663344 CTTTATTTACAGAAATAAGCGGG + Exonic
1029689774 7:102173599-102173621 CTTCCTTTGCAGAATGAAGCAGG - Intronic
1030455722 7:109772000-109772022 TTTTTTTTGCAGAAATAAACAGG + Intergenic
1030686904 7:112496439-112496461 TTTTATTTGCAGAAAGAAGGGGG + Intergenic
1031020529 7:116622633-116622655 TTAGAGTTGCAGCAAGAAACAGG - Intergenic
1031205479 7:118751754-118751776 CTTGTTTTTAAGAAAGAAAAAGG - Intergenic
1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG + Intronic
1036736212 8:11319195-11319217 CTTGTTGTGCAGAAACAACCAGG - Intronic
1036802820 8:11805214-11805236 CCTAGTTTGCAGAGAGAAACTGG - Intronic
1036950173 8:13132962-13132984 CTTGATGTGCAGAAAGAAGCCGG - Intronic
1037022135 8:13986605-13986627 TTTGAGTTTCAGAAAGAACCTGG + Intergenic
1038207616 8:25482186-25482208 CTTTATTTGCAGAAACACACAGG + Intronic
1038405876 8:27322380-27322402 CCTGGTTTGCAGAAAGGAAAAGG - Exonic
1039002190 8:32994249-32994271 CTGGAGTTGAAGAAAGCAACTGG - Intergenic
1039622904 8:39016251-39016273 TTTAATTTGGAGACAGAAACAGG - Intronic
1041133668 8:54732630-54732652 CATGAGTTCCAGAGAGAAACTGG - Intergenic
1041394659 8:57378246-57378268 TTTGTTTAGCTGAAAGAAACTGG - Intergenic
1041465063 8:58150363-58150385 GGTGGTTTTCAGAAAGAAACAGG - Intronic
1042335397 8:67624903-67624925 CTTTATGTGCAGAAAGCAGCAGG - Intronic
1042657749 8:71118901-71118923 CTTGAGCTACAGAAAGAAATAGG - Intergenic
1042701090 8:71615514-71615536 TTTGATTTGCTGTAATAAACTGG + Intergenic
1043002251 8:74773267-74773289 TTTAATTTTCAGAAAGAAAATGG - Intronic
1043151498 8:76722516-76722538 CTTGAGTTACAGAAAGATATAGG - Intronic
1043395214 8:79828822-79828844 CTTGATCTACAGATAAAAACAGG + Intergenic
1043742848 8:83835957-83835979 TTTCATTTCCAGAAAGAAAATGG - Intergenic
1043805451 8:84667106-84667128 ATTCATTTGCAGAAGAAAACAGG + Intronic
1045596039 8:103657718-103657740 CTTCATTTTCATAAAGAAACTGG - Intronic
1045926611 8:107583552-107583574 TTTAATTTGCAGAAGGAAAGAGG - Intergenic
1046202675 8:110947885-110947907 CTTAATTTGGAGAAAAAAACTGG - Intergenic
1046233724 8:111393281-111393303 CTTCCTTTGCAGTAAGAAAAAGG + Intergenic
1046566644 8:115910592-115910614 CTTGTTTTACAAAGAGAAACAGG - Intergenic
1046741902 8:117837994-117838016 CTTCACTGGCATAAAGAAACAGG - Intronic
1047073689 8:121376343-121376365 CTTGAGTTGCAGAAAGTGAAAGG + Intergenic
1047190721 8:122676817-122676839 CTTTATTTACAAAAACAAACAGG + Intergenic
1047230941 8:122997204-122997226 TTTCATTTGCAAAAAGTAACTGG + Intergenic
1047388323 8:124430010-124430032 CTTGACTTGCTGGAAGAAAATGG + Intergenic
1047763634 8:127972283-127972305 CTTGCTTTGCAGAAAGTCACTGG + Intergenic
1048862218 8:138731935-138731957 CTTGATTTCCAGAAGAAAAAAGG - Intronic
1049054890 8:140228423-140228445 CTTAATTTCCATAAAGAAAGCGG + Intronic
1049901213 9:167750-167772 CTTGATTTAAAGTGAGAAACAGG - Intronic
1050885179 9:10755485-10755507 ATTGATTTGAAGAACAAAACTGG + Intergenic
1053744252 9:41178064-41178086 CTTGATTTAAAGTGAGAAACAGG - Intronic
1054349529 9:64007962-64007984 CTTGATTTAAAGTGAGAAACAGG - Intergenic
1054483018 9:65687134-65687156 CTTGATTTAAAGTGAGAAACAGG + Intronic
1054684092 9:68253189-68253211 CTTGATTTAAAGTGAGAAACAGG + Intronic
1055020412 9:71663502-71663524 CTTGATTTACAGGAATCAACAGG - Intergenic
1056802119 9:89699530-89699552 CTTGATTGGCTGAATGAAAAAGG + Intergenic
1059518056 9:114914042-114914064 TTTGATTTGCAGAATGATTCTGG - Intronic
1059874347 9:118617602-118617624 CTTGATTTCCAGCATGGAACAGG + Intergenic
1061026201 9:128051379-128051401 CTTCTTTTGTAAAAAGAAACAGG + Intergenic
1203490839 Un_GL000224v1:103047-103069 CTTCACTTGCTGAAAGACACCGG - Intergenic
1203503463 Un_KI270741v1:44925-44947 CTTCACTTGCTGAAAGACACCGG - Intergenic
1186256924 X:7731994-7732016 CTACATCTGCAGAATGAAACTGG - Intergenic
1186762174 X:12734575-12734597 CTTCTTATGCAGATAGAAACAGG - Intergenic
1187531827 X:20104252-20104274 CATGTTTTGCAGTAAGAAAATGG + Intronic
1187817635 X:23249944-23249966 TTTGATTTGCAGAGTGAAACTGG + Intergenic
1188038543 X:25345307-25345329 CTTCATTTGGAGAAAAATACAGG + Intergenic
1188900501 X:35727164-35727186 CTTGATTTGATAAAAGAAAGAGG + Intergenic
1189644157 X:43108495-43108517 CTTGATTATCAGAAAGTATCAGG - Intergenic
1190402824 X:50056197-50056219 ATTAATTTCCAGAAGGAAACTGG - Intronic
1192456960 X:71283946-71283968 GATGAGTTGCACAAAGAAACAGG - Intronic
1195526569 X:105897665-105897687 CTAGATTTTTAAAAAGAAACAGG - Intronic
1195827484 X:109018047-109018069 CTCGATTTCCAGAAAGAAATTGG - Intergenic
1195879599 X:109578609-109578631 CTTCTTCTGAAGAAAGAAACAGG - Intergenic
1195915936 X:109935533-109935555 CTTGATTTTCAGAAATAAACAGG + Intergenic
1196217912 X:113076651-113076673 CTTCTTTTGCAGAAACAAATGGG + Intergenic
1196316392 X:114230107-114230129 TTTGCTTTGGAGAAAGAATCAGG - Intergenic
1196542998 X:116931480-116931502 CTTGATTTGCTTAAGGGAACAGG - Intergenic
1196623640 X:117852838-117852860 CTTGAAATACAGAAAGAAACTGG + Intergenic
1197280111 X:124525667-124525689 CTTGTTTTGTAGAAAGAATGTGG + Intronic
1197955667 X:131944821-131944843 GTGGTTTTGCAGAAAGAAATTGG - Intergenic
1198843843 X:140888176-140888198 CCTGATAGGCAGAAAGAAAATGG + Intergenic
1199767295 X:150950423-150950445 CTGGGGATGCAGAAAGAAACTGG + Intergenic
1201583231 Y:15532775-15532797 CTTGCTCTGTAGAAAGATACTGG - Intergenic