ID: 1118141949

View in Genome Browser
Species Human (GRCh38)
Location 14:63093479-63093501
Sequence GGGGCAGTCCTGTGAAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 484}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118141942_1118141949 6 Left 1118141942 14:63093450-63093472 CCTGTGCTTGCAGTCGGCATCTG 0: 1
1: 0
2: 2
3: 18
4: 137
Right 1118141949 14:63093479-63093501 GGGGCAGTCCTGTGAAATGGAGG 0: 1
1: 0
2: 4
3: 44
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118141949 Original CRISPR GGGGCAGTCCTGTGAAATGG AGG Intronic
900488126 1:2933164-2933186 GGGGCAGTCTGGGGAAATGCAGG - Intergenic
900766715 1:4510814-4510836 GGGGCTGTCCTGTGCACTGTAGG + Intergenic
901179805 1:7333853-7333875 TGGGCATTCCAGTGAAATGGAGG + Intronic
901185923 1:7373158-7373180 GGGGCTGTCCTGTGCATTGTAGG + Intronic
901800605 1:11706014-11706036 GGGGCTGTCCTGTGCATTGTCGG + Intronic
901882525 1:12202493-12202515 CTGACAGTCCTGTGAAAGGGAGG - Intronic
902289065 1:15425010-15425032 GGGGCTGTCCTGTGCATTGTGGG - Intronic
903344524 1:22675936-22675958 GGGGCGGTCCTGTGCATTGCAGG - Intergenic
903508428 1:23854796-23854818 GGGGCTGTCCTGTGCATTGTAGG - Intronic
904863001 1:33553808-33553830 GGGGCTGTCCTGTGCATTGTAGG + Intronic
905238250 1:36565239-36565261 GGGGCAGCTCTGGGAACTGGCGG + Intergenic
905775805 1:40666386-40666408 GGGGCTGTCCTGTGCATTGAAGG - Intergenic
906149964 1:43581899-43581921 GGGGCCATCCTGTGCATTGGAGG + Intronic
906778628 1:48552558-48552580 GGGGCAGCCCTGTGCATTGTAGG + Intronic
907873679 1:58465913-58465935 GAAGCAGTCCTGAGAAAAGGTGG - Intronic
908214614 1:61938089-61938111 GGGGCAGTCCTTTGCATTGTAGG + Intronic
908334440 1:63106383-63106405 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
909481800 1:76134163-76134185 TAGGCAATCCTGTGGAATGGCGG + Intronic
910365382 1:86459793-86459815 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
910401569 1:86842787-86842809 AGGGCAGGCCAGTGAATTGGGGG + Intergenic
910653090 1:89590989-89591011 GGGGCTGTCCTGTGCAGTGTAGG - Intronic
911180351 1:94854860-94854882 GGGGCTGTCCTGCGCACTGGAGG - Intronic
911626995 1:100135125-100135147 GGGGCTGTCCTGTGATTTGTAGG - Intronic
912198070 1:107423395-107423417 GGGGCTGTCCTGTGCATTGTAGG - Intronic
912572650 1:110635782-110635804 TGGGGAGTCCTGTGAGCTGGTGG + Intergenic
914241668 1:145857037-145857059 AGGGCAGGCCTGTGCAAGGGAGG - Intronic
915083967 1:153371915-153371937 GGGGCAGAACTTTGAAAGGGGGG - Intergenic
915244330 1:154545497-154545519 GGGGCAGTCAGGAGAAGTGGAGG + Intronic
915725274 1:158012900-158012922 GGGGCTGTCCTGTACATTGGAGG + Intronic
915739542 1:158108145-158108167 GGGGCTGTCCTTTTAAAAGGAGG - Intergenic
916000164 1:160607719-160607741 GGGGCTGTCCTGTGCACTGTAGG - Intergenic
916194222 1:162208552-162208574 GGGGCTGTCCTGTGTACTGTGGG + Intronic
916212570 1:162370819-162370841 GGGGCTGTCCTGTGCATTGTAGG - Intronic
917869005 1:179225675-179225697 GGGGCTGTCCTGTGCATTGTAGG - Intronic
917960287 1:180138228-180138250 GGGGCTGTCCTGAGCAATGAAGG + Intergenic
918047807 1:180952049-180952071 GAGGCAGTCCTGTGCAGTGTTGG + Intergenic
918235311 1:182574589-182574611 GGGGCTGTCCTGTGCAAGGCAGG + Exonic
919762062 1:201104223-201104245 GGGGCTGTCCTGTGCATTGCAGG + Intronic
921951277 1:220932557-220932579 GGGGTTGTCCTGTGCAATGTAGG - Intergenic
922236653 1:223727331-223727353 GGGGCTGTCCTGTGAATTATAGG + Intronic
922271788 1:224042214-224042236 GATGCAGACCTGTGAAATTGAGG - Intergenic
924260901 1:242230082-242230104 GGGGCTATCCTGTGCAATGCAGG - Intronic
924730854 1:246710369-246710391 GGGGCAGGCATGTCACATGGCGG + Intergenic
1063218992 10:3948940-3948962 GGGTCAGCCCTGTGACCTGGAGG + Intergenic
1063539016 10:6913360-6913382 GGGGCTGTCCTGTGTGTTGGTGG + Intergenic
1063587616 10:7366822-7366844 GGGGCTGTCCTGTGCATTGCGGG + Intronic
1064014387 10:11761342-11761364 GGGGCTGTCCTGTGCATTGCAGG - Intronic
1064217794 10:13415201-13415223 GGGGCTCTCCTGTGCAATGCTGG - Intergenic
1064565250 10:16633079-16633101 GGGGCTGTCCTGTGAACTGTAGG + Intronic
1065317609 10:24479571-24479593 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1066496279 10:35945207-35945229 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1066518653 10:36192224-36192246 GGGGGAGGACTGTGAAATTGTGG - Intergenic
1067687673 10:48476895-48476917 GGGGCAGAACTGAGAAGTGGAGG - Intronic
1067762308 10:49057583-49057605 AGGGCAGGCCTGTGAGATGGGGG - Intronic
1068866315 10:61898878-61898900 GGGGCAGTGCTGTAAAAAGAGGG + Intergenic
1069580361 10:69561764-69561786 GGTGCAGTCCCCTGAAATGAAGG - Intergenic
1069641836 10:69961373-69961395 GGTGCAGTCCAGTGATAGGGTGG - Intronic
1070371858 10:75790167-75790189 GGGGCCGTCCTGTGCATTGTAGG + Intronic
1071683980 10:87735696-87735718 AGGGCAGTTCTGTGCAATGTAGG + Intronic
1071872526 10:89811047-89811069 GGGGCAGTCCTGGTTAATGCTGG + Intergenic
1071940131 10:90581084-90581106 GAGGCAGTCATGAGAAATGCAGG - Intergenic
1072342126 10:94462354-94462376 GGGGCTTTCCTGTGAAATACAGG + Intronic
1074699354 10:116079663-116079685 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1074817288 10:117152015-117152037 GGGGCAGTCTTGTTAGATGTTGG - Intergenic
1075507477 10:123037162-123037184 GGGGCTGTCCTGTGCATTGCAGG - Intronic
1075620236 10:123922087-123922109 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1075916607 10:126173433-126173455 GGGGCTGTCCTGTGTAATGGAGG + Intronic
1076527130 10:131118957-131118979 GGGGCTGTCCTGTGCATTGCAGG - Intronic
1077106423 11:844411-844433 GGGGCTCTGCTGGGAAATGGAGG - Intronic
1077333401 11:1993165-1993187 TGGGCAGTGCTGGGAGATGGTGG + Intergenic
1079453036 11:20613852-20613874 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1080715076 11:34792321-34792343 GGGGCAGTCCTGTGCATTGTAGG - Intergenic
1081864094 11:46350275-46350297 GGGGCAGACATGTGGAAGGGTGG + Intronic
1083140928 11:60720954-60720976 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1083330845 11:61897726-61897748 GGGGCAATTCTGTGCTATGGAGG + Exonic
1083701695 11:64483545-64483567 GGGGCTGTCCTGGACAATGGGGG + Intergenic
1083760594 11:64814745-64814767 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1084257331 11:67952085-67952107 GGGGCCGTCCTGTGTATTGTAGG - Intergenic
1084331411 11:68432725-68432747 GGAGGAGTCCTAGGAAATGGGGG + Intronic
1084815447 11:71643181-71643203 GGGGCCGTCCTGTGTACTGTAGG + Intergenic
1085014358 11:73163154-73163176 TGAGCACTCCTGTGACATGGGGG + Intergenic
1086940052 11:92787003-92787025 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1088326408 11:108605542-108605564 GGGGCTGTCCTGTATAATGTAGG - Intergenic
1088440587 11:109866443-109866465 GCTTCAGTCCTGTGAAATGGGGG - Intergenic
1089519540 11:119054778-119054800 GGGGCTGTCCTGTGCACTGTAGG + Intronic
1090381432 11:126330293-126330315 GGGGCTGTCCTGTGCATTGAAGG - Intronic
1091031046 11:132188193-132188215 GGGGCTGTCCTGTGCATTGCAGG - Intronic
1091344880 11:134845944-134845966 GGGGCAGTGCTGGGAGATTGGGG - Intergenic
1202816379 11_KI270721v1_random:48346-48368 TGGGCAGTGCTGGGAGATGGTGG + Intergenic
1092132583 12:6123104-6123126 GGGGCAGGAATGAGAAATGGAGG + Intronic
1092428831 12:8393849-8393871 GGGGCCGTCCTGTGTATTGTAGG - Intergenic
1093099740 12:15013511-15013533 GGGGCTGTCCTGTGCATTGCAGG + Intergenic
1094175738 12:27539006-27539028 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1094434003 12:30400642-30400664 AAGGCAGCCCTGTGAAAGGGAGG - Intergenic
1095657713 12:44689818-44689840 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1095951337 12:47783538-47783560 TGTGCAGTCCTGAGGAATGGGGG + Exonic
1098311803 12:69156385-69156407 GGTGCTGTCCTGTGCAATGTAGG + Intergenic
1098850863 12:75594327-75594349 GCGGCAATCCCCTGAAATGGGGG + Intergenic
1098973717 12:76880072-76880094 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1099653670 12:85461630-85461652 GGGGCTGTCCTGTGCATTGCAGG + Intergenic
1100979228 12:100151891-100151913 GGGACAATCCTGGGAATTGGAGG - Intergenic
1101057716 12:100936306-100936328 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1101308259 12:103553114-103553136 GGGGCTGTCCTGTGCATTGCAGG + Intergenic
1101416879 12:104516134-104516156 GAAGCTGTCCTGTGCAATGGAGG + Intronic
1101565286 12:105899158-105899180 GGGGCTGTCCTGTGCAATGTAGG - Intergenic
1101633399 12:106517170-106517192 GGGGCTGTCCTGTGCATTGTGGG + Intronic
1101878620 12:108611377-108611399 GGGGCTGTCCTGTGCACTGTGGG + Intergenic
1101938944 12:109084552-109084574 GGGGCTGTCCTGTGCATTAGAGG - Intronic
1101948961 12:109159658-109159680 GGGGCTGTCCTGTGCATTGCAGG + Intronic
1102366478 12:112340578-112340600 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1102532275 12:113555263-113555285 GGGGCTGTCCTGTGAACTGGAGG - Intergenic
1102622274 12:114205574-114205596 GGGGCTGTCCTGTGGACTGTAGG - Intergenic
1102792648 12:115660166-115660188 GGGGCTGTCCTGTGCATTGTGGG - Intergenic
1102859404 12:116322225-116322247 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1102882162 12:116493903-116493925 GGGGCTGTCCTGTGCACTGTAGG - Intergenic
1102941471 12:116946452-116946474 GGGGCTGTCCTGTGCATTGCAGG + Intronic
1103101786 12:118182406-118182428 GGGGCCGTCCTGTGCATTGCAGG + Intronic
1103136005 12:118508467-118508489 GGGGCTGTCCTGTGCATTGCAGG + Intergenic
1103278434 12:119733711-119733733 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1103409556 12:120701090-120701112 CAGGCAGTCTTGTGAGATGGGGG + Exonic
1103910868 12:124351385-124351407 GGGGCTGTCCTGTGCACTGTGGG + Intronic
1103955784 12:124576013-124576035 GGGGACGCCCTGGGAAATGGGGG + Intergenic
1104054984 12:125222710-125222732 GGGGCTGTCCTGGGAATTGTAGG + Intronic
1104268162 12:127257397-127257419 GGGGCTGTCCAGTGAAAACGTGG - Intergenic
1104615940 12:130268583-130268605 GGGGCCGTCCTGTGCACTGCGGG - Intergenic
1104732838 12:131117905-131117927 GGGGCAGTCTTGTGCATTGTAGG + Intronic
1105380198 13:19880082-19880104 TAGGAAGTCCTGTGAACTGGAGG - Intergenic
1105572054 13:21611935-21611957 GGGGCTGTGCTGTGAACTGCAGG + Intergenic
1105804979 13:23947396-23947418 GCAGCAGTCCTGGGAACTGGGGG - Intergenic
1106209394 13:27627374-27627396 AGCACAGTCCTGAGAAATGGTGG + Intronic
1106309668 13:28543234-28543256 GGAGCTGTCCTGTGCATTGGAGG - Intergenic
1106375099 13:29178512-29178534 GGGGCTGTCCTGTGAACTGTAGG + Intronic
1108310635 13:49186335-49186357 GGGGTAGCACTGTGAAATGAAGG + Intronic
1112380902 13:98889019-98889041 GTGGCTGTCCTGTGAAATACAGG - Intronic
1112514382 13:100039318-100039340 GGGGCTGCCCTGTGTACTGGAGG - Intergenic
1112761432 13:102697400-102697422 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1112900049 13:104346554-104346576 AGAGCAGTCCAGTTAAATGGTGG - Intergenic
1113127435 13:106995422-106995444 CGGGCTGTCCTGTGCAATGTAGG - Intergenic
1113532149 13:111035961-111035983 GGGGCCGTCCTGTGCCCTGGCGG + Intergenic
1114261193 14:21037563-21037585 GGAGCTGTCCTGTGAAATGTGGG - Intronic
1115439126 14:33411561-33411583 AGGGCTGTCCTGTGCACTGGAGG - Intronic
1115855544 14:37625975-37625997 GTGGCTGTCCTGTGAATTGTAGG + Intronic
1117438666 14:55741012-55741034 GGGGCTGTCCTGTGCACTGTGGG + Intergenic
1118077504 14:62316557-62316579 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1118141949 14:63093479-63093501 GGGGCAGTCCTGTGAAATGGAGG + Intronic
1119071594 14:71590834-71590856 GGGGCTGTCCTGTGTATTGTAGG + Intronic
1119168701 14:72516321-72516343 AGGGCAGGCCTGGGAGATGGAGG + Intronic
1119558520 14:75571623-75571645 AGGGCATTCCTGTGCCATGGGGG - Intergenic
1119709423 14:76811175-76811197 GGGTCTGTCCTGTGAATTGTTGG - Intronic
1119728759 14:76938047-76938069 GAGGAAGGCCTGTGAAATGCCGG + Intergenic
1119798959 14:77425688-77425710 GGGGCTGTCCTGTGGATTGTAGG + Intergenic
1120354915 14:83419969-83419991 GGGGCTGTCCTGTGAATTGCAGG + Intergenic
1120987132 14:90343953-90343975 GGGGCAGTCCTGGGCATTGTAGG - Intergenic
1121305011 14:92900695-92900717 GAAGCAGTGCAGTGAAATGGAGG - Intergenic
1121636352 14:95456451-95456473 GGGGCTGTCCTGTGCACTGTAGG + Intronic
1121884294 14:97528857-97528879 GGGGCTGTCCTGTGCACTGTAGG + Intergenic
1121951092 14:98171752-98171774 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1122146672 14:99693179-99693201 GGGGCAATTCTCTGCAATGGAGG + Intronic
1122257733 14:100491283-100491305 GGGGCAAGACTGTGAACTGGGGG + Intronic
1122569773 14:102688561-102688583 GGGTCAGTGCTGTTAAAAGGCGG + Intronic
1125642704 15:41244634-41244656 GGGGCTGTCCTGTGCACTGTAGG - Intronic
1125966359 15:43878688-43878710 GGGGCAGGCCTTTGAAAGGGTGG - Intronic
1126056595 15:44735639-44735661 GGGGCTGTCCTGTGAATTTTAGG - Intronic
1126377016 15:48006969-48006991 GGGGCTGTCCTGTGTATTGTAGG - Intergenic
1127060058 15:55173151-55173173 GGGGCTGTCCTGTGCATTGCAGG + Intergenic
1127791425 15:62401968-62401990 GGGGCTGTCCTGTGCATTGCAGG - Intronic
1128632737 15:69282242-69282264 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1128727407 15:69998448-69998470 GGGACTGTCCTGTGTAATGCAGG + Intergenic
1129342561 15:74895798-74895820 GGGGCTGTCCTGTGTACTGATGG - Intronic
1129504128 15:76066900-76066922 GGGGCAGTCCTGTGCATTGTAGG + Intronic
1129873661 15:78958040-78958062 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1130176635 15:81578700-81578722 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1130223321 15:82039645-82039667 GGGGCTGTCCTGTGCAATGTAGG + Intergenic
1130231946 15:82103905-82103927 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1130305201 15:82708834-82708856 GGGACAGTCGAGTGTAATGGGGG - Intronic
1130759502 15:86803884-86803906 GGGGCTGACCTGTGAATTGTAGG - Intronic
1130844221 15:87729403-87729425 GGGGCATTCCTGTGAAATGAAGG - Intergenic
1130853464 15:87820385-87820407 GAGGCTGTCCTGTGCAATGTAGG + Intergenic
1130898385 15:88188444-88188466 GGGGCTGTCCTGTGCATTGCAGG - Intronic
1130913446 15:88286712-88286734 GAGGCTGTCCTGTGAATTGTAGG - Intergenic
1130918603 15:88325242-88325264 GGGGCTGTCCTGTGCATTGTTGG - Intergenic
1130928107 15:88400117-88400139 GGGGCTGTCCTGTGCACTGTAGG - Intergenic
1131016057 15:89058617-89058639 GGGGCACTCCTGAGGGATGGAGG - Intergenic
1131018991 15:89082021-89082043 GGGGCTGTCCTGGGCACTGGAGG + Intergenic
1131152293 15:90054575-90054597 GGGGCAGTCCTCTGGGATGGGGG - Intronic
1131555973 15:93399265-93399287 GGGGCTGTCCTGTGTATTGAGGG + Intergenic
1133019876 16:2962736-2962758 GGGGCAGGCCTGCACAATGGCGG - Intergenic
1133102166 16:3486170-3486192 GGGGCAGTCCTGTGCCTTGTGGG + Exonic
1133568013 16:7013496-7013518 GGGACTGTCCTGTGTAATGCAGG - Intronic
1133985288 16:10663686-10663708 GGGGCTGTCCTGTGCATTGGGGG + Intronic
1133995694 16:10746362-10746384 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1134064102 16:11215930-11215952 GGGGCAGGCATGTCACATGGCGG - Intergenic
1134530234 16:14976750-14976772 GGGGCTGTCCTGTGCAACGTAGG - Intronic
1134628834 16:15742103-15742125 GGGGCTGTCCTGTGCACTGTAGG - Intronic
1135631021 16:24035626-24035648 GGGGCAGTCCAGTGGAGGGGTGG + Intronic
1135792457 16:25409747-25409769 GGGGCTGTCTTGGGAACTGGAGG + Intergenic
1136031473 16:27506347-27506369 GGGGCTGTCCTGTGTATTGCAGG + Intronic
1136041464 16:27582735-27582757 GCCACAGTCCTGTGAAATGCAGG - Intronic
1137056890 16:35750268-35750290 GGGGCAGTCCTGGGCTGTGGCGG - Intergenic
1137395176 16:48112029-48112051 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1137769225 16:51002986-51003008 GGGTCACGCCTTTGAAATGGGGG - Intergenic
1137789713 16:51164859-51164881 GGGGCTGTCCTGTGCAGTGTAGG - Intergenic
1139231292 16:65285011-65285033 GGGGCTGTCATTTCAAATGGAGG + Intergenic
1139701464 16:68710498-68710520 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1139866109 16:70064204-70064226 GGGGCTGTCCTGTGCAACGTAGG + Intergenic
1140194517 16:72845517-72845539 GGGGCAGTGATGTGAGTTGGGGG - Intronic
1140477665 16:75247100-75247122 TGGGCAGTACTGTGAGGTGGGGG - Intronic
1140703998 16:77609222-77609244 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1140906344 16:79412528-79412550 GGGGCTGTCCTGTGTATTGCAGG + Intergenic
1141199210 16:81884018-81884040 GGGGCTGCCCTGTGCAATGTAGG - Intronic
1141343251 16:83222921-83222943 GGGGCTGTCCTGTGAATTGTAGG + Intronic
1141344889 16:83235259-83235281 GGGGCTGACCTGTGCATTGGAGG - Intronic
1141484845 16:84331911-84331933 GGGGCTGTCCTGTGCAGTGTAGG + Intergenic
1141660963 16:85441186-85441208 GGGGCTGTCCTGTGGATTGTAGG + Intergenic
1144459649 17:15448117-15448139 AGCGCAGTCCTGGGAAATGCCGG - Intronic
1145765093 17:27453527-27453549 GGGGCAGTTCTGTAAACTTGTGG + Intergenic
1146180653 17:30696197-30696219 GGGGCTGTCCTGTGCACTGTAGG - Intergenic
1147146065 17:38485174-38485196 GGGGTTGTCCTGTGCACTGGAGG + Intronic
1147428493 17:40357396-40357418 GGGGCAGGCCAGGGAAATGGAGG - Intronic
1147428972 17:40360040-40360062 GGGGCTGTCCTGTGCATTGCAGG + Intergenic
1148083924 17:44982866-44982888 AGGGCATTGCTGTGAAAAGGAGG - Intergenic
1148955518 17:51350647-51350669 GGGGCAGTCCTGTGCATTTTGGG - Intergenic
1149304942 17:55338600-55338622 GGGGCTGTCCTGTGCATTGTGGG + Intergenic
1149517703 17:57292867-57292889 GGGGCATACCTGTGAGAGGGAGG - Intronic
1150078992 17:62219735-62219757 AGGGCAGTTTTGTGAGATGGAGG - Intergenic
1151135137 17:71939223-71939245 GGTGCCGTCCTGTGCGATGGAGG + Intergenic
1151562167 17:74876455-74876477 GGGGCTGTCCTGTGCATTGTTGG - Intergenic
1151867276 17:76812364-76812386 GGGGCTGTCCTGTGTATTGCAGG + Intergenic
1152188374 17:78873161-78873183 GGGACAGCCGTGTGATATGGTGG - Intronic
1152639248 17:81442839-81442861 GGCACAGTCCTGTGAAGAGGTGG - Exonic
1152644017 17:81460635-81460657 GGGGCCGTCCTGTGCTTTGGGGG - Exonic
1153284408 18:3445051-3445073 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1153560701 18:6369404-6369426 GGGGCTGTCCTGTGCATTGTGGG - Intronic
1155087781 18:22474535-22474557 GGGGCTGTCCTGTGCCATGTAGG + Intergenic
1155302902 18:24449009-24449031 GGGTCAGGCCTGTAAACTGGTGG + Intronic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1155498755 18:26466571-26466593 GGGGCTGTCCTGTGCAATATAGG - Intronic
1155702762 18:28768454-28768476 GGGGCAGTCCTGTGAAACAGTGG - Intergenic
1156362240 18:36393384-36393406 GGGGTTGTCCTGTGAATTGTAGG + Intronic
1156563851 18:38160956-38160978 AGGGCAGTCCTGTGACTTAGAGG + Intergenic
1157385521 18:47256860-47256882 GAGGGGGTCCTTTGAAATGGAGG + Intergenic
1158590143 18:58772240-58772262 GGGGCTGTCCTGTGTATTGGAGG - Intergenic
1160132011 18:76233852-76233874 GGGGCTGTCCTGTGCACTGTAGG + Intergenic
1161816941 19:6504998-6505020 GGGGCCGTCCTGTGCACTGAAGG - Intergenic
1162339708 19:10085316-10085338 GGGACTGTCCTGTGTATTGGGGG - Intergenic
1162834207 19:13305574-13305596 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1162859108 19:13492153-13492175 GAGGCAGTCCAGTGTAGTGGAGG - Intronic
1162977932 19:14219336-14219358 GGGGCTGTCCTGTGCACTGTAGG + Intergenic
1164740178 19:30570043-30570065 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1165751942 19:38265363-38265385 AGGCCAGGCCTGTGAGATGGTGG + Intronic
1165755497 19:38290478-38290500 GCGGCAGCTCTGTGGAATGGGGG + Intronic
1166533021 19:43553675-43553697 GGGGGAGTCCTGGGAAAGGAGGG + Exonic
1167075036 19:47243322-47243344 GGGGCGGGCCTGCGAAATCGGGG - Intergenic
1167092786 19:47356068-47356090 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1167215970 19:48164863-48164885 GGGGCTGTCCTATGAATTGAAGG + Intronic
1167459779 19:49618760-49618782 TGGGCAGGCCTGGGAAAGGGTGG - Intronic
1167483449 19:49746613-49746635 GGGGCAGCCCTGGGACGTGGCGG + Exonic
1167871034 19:52370320-52370342 GGGGCAGGCCTGTGAAAAGAGGG - Intronic
1167921926 19:52789076-52789098 GGGGCTGTCATGTCAAATGGGGG + Intronic
1167932162 19:52874730-52874752 GGGGCTGTCATGTCATATGGGGG + Intronic
1168281945 19:55310663-55310685 GGGGCTGTTCTGTGAATTGTAGG - Intronic
1168291019 19:55357602-55357624 GGGGCTGTCCTGTGCACTGTAGG + Intronic
1168314706 19:55479614-55479636 GGGGCCGTCCTGTGAATTGTAGG + Intronic
925077794 2:1032971-1032993 GGGGCAGTCATGTCACATGGTGG + Intronic
925898047 2:8488365-8488387 GGGGGATCCCTGTGAGATGGGGG - Intergenic
926143639 2:10383813-10383835 GGGGCTGTCCTGTGCATTGTGGG + Intronic
926371271 2:12181163-12181185 GGGGCTGTCCTGTGTAACGTGGG + Intergenic
926570158 2:14520735-14520757 GCGGCAGTGCTGAGAACTGGGGG - Intergenic
926623558 2:15070470-15070492 GAGCCACTCCTGAGAAATGGAGG - Intergenic
927249164 2:20982582-20982604 TGGGCTGACCTGTGACATGGGGG + Intergenic
928410836 2:31052669-31052691 GGTGCTGTCCTGTGCAGTGGAGG - Intronic
928495077 2:31823159-31823181 GGCGAAGTCCTGAGATATGGGGG + Intergenic
930129499 2:47835120-47835142 GGGGCTGTCCTGTGCACTGTAGG + Intronic
930607324 2:53505969-53505991 TGGACAGTCCTGTGGAATGTGGG - Intergenic
930799141 2:55424290-55424312 AGGGCAGTGCCGTGCAATGGAGG + Intergenic
931412792 2:62049524-62049546 GGGGCTGTCCTGTGCATTAGGGG - Intronic
931745765 2:65290792-65290814 GGGGCTGTCCTGTGCATTGTGGG - Intergenic
932122559 2:69115069-69115091 GGGCCTGTCCTGTGCATTGGAGG + Intronic
932489023 2:72106710-72106732 GGGGCTGCCCTGTGCATTGGAGG + Intergenic
934886557 2:98030474-98030496 GGAGGAGTCCTGGGAAATGTGGG - Intergenic
935057520 2:99580543-99580565 GGGGCTGTCCTGTGCAACGTAGG - Intronic
935498990 2:103815353-103815375 AGGGCAGACCTGGGCAATGGAGG + Intergenic
936163243 2:110100700-110100722 GGGACAGTGCTGTGAAGGGGAGG - Intronic
936946009 2:117931546-117931568 GGGGGTGTCCTGTGCAATGTAGG - Intronic
937212230 2:120282009-120282031 GGGGCTGTCCTGTGTGATGTAGG - Intronic
937849616 2:126620892-126620914 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
938933837 2:136111581-136111603 GGGGCTGTCCTGTGTATTGTAGG + Intergenic
939663225 2:144916845-144916867 AGGGCAATCCTTTGAAATTGAGG - Intergenic
942414707 2:175746535-175746557 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
945296546 2:208176547-208176569 GGGGCTGTCCTGTGCATTGTGGG - Intronic
946334631 2:219028787-219028809 GGGGGAGGCCTTGGAAATGGAGG - Intronic
946539531 2:220668874-220668896 GTGGCAGTGCTGTGTAATTGGGG - Intergenic
946959524 2:224969162-224969184 GCAGCAGTCCTCTCAAATGGGGG + Intronic
947370562 2:229441169-229441191 GGGGAAGTCCTGGGTCATGGGGG - Intronic
947907683 2:233777420-233777442 GGGGCAGTCCTGTGAAAGAAGGG + Intronic
948076413 2:235168359-235168381 GGAGCAGTCTTGGGAAAGGGCGG - Intergenic
948098447 2:235354946-235354968 GGGGCTGTCCTGTCCATTGGAGG - Intergenic
948178633 2:235962818-235962840 GGGGCTGTCCTGTGCATTGTAGG + Intronic
948749573 2:240124018-240124040 GGCTCAGTCCTCTGAACTGGAGG - Intergenic
1169039346 20:2480219-2480241 GGGGCAGTTCTGGCAAAGGGTGG + Intronic
1170586018 20:17734723-17734745 GGGGCTGTCCTGTGCATTGCAGG - Intronic
1170604414 20:17864928-17864950 GGGGCTGTCCTGTGTATTGCAGG - Intergenic
1171163699 20:22952047-22952069 GGGGCTGTCCTGTGTGTTGGGGG - Intergenic
1171197831 20:23215125-23215147 GGTGTAGTCCTGTGCACTGGAGG - Intergenic
1172248479 20:33462546-33462568 GGGCCAGGCCTGGGAAATGGAGG - Intergenic
1173235742 20:41244054-41244076 GGGGCTGTCCTGTAAATTGCAGG + Intronic
1173353686 20:42267676-42267698 GGGGCTGTCCTGTGCACTGTAGG - Intronic
1173609932 20:44359638-44359660 GGGGCTGTCCTGTGCACTGTAGG + Intronic
1173907389 20:46638820-46638842 GGGGCTGTCCTGTGCATGGGAGG + Intronic
1174285578 20:49470525-49470547 GGGGCTGTCCTGTGCATTGGAGG - Intronic
1174509228 20:51038432-51038454 GGGGCTGTCCTGTGCATTGCAGG + Intergenic
1174535654 20:51249234-51249256 GGGGCTCTCCTGTGCACTGGAGG + Intergenic
1174589298 20:51632499-51632521 GGGGCTGTCCTGTGCATTGCAGG + Intronic
1174705202 20:52648072-52648094 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1174736281 20:52968933-52968955 GGGGCTGTCCTGTTCAATGTAGG - Intergenic
1174797150 20:53531689-53531711 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1174962994 20:55178853-55178875 GGGGCTGTCCTGTGTATTGTAGG + Intergenic
1175003420 20:55655342-55655364 GGGGGCGTCCTGTGCATTGGAGG - Intergenic
1175168552 20:57063455-57063477 GGGGCCGTCCTGTGCAATGTAGG + Intergenic
1175392345 20:58635386-58635408 GGGGCCGTCCTGTGCACTGTAGG - Intergenic
1176068417 20:63212862-63212884 GGGGCTGTCCTGTGCATTGTTGG - Intronic
1176236200 20:64054637-64054659 GGGGCAGGCCTGTGTTCTGGGGG + Intronic
1176530239 21:7952491-7952513 AGGGCAGTGGTGTGGAATGGAGG - Intergenic
1177786716 21:25679559-25679581 GGGGCTGTCCTGTGCACTGTAGG - Intronic
1178715740 21:34962905-34962927 AGGGCAGGCCTGTGATGTGGTGG - Intronic
1178737894 21:35169192-35169214 GGGGCTGTCCTGTGCACTGTAGG + Intronic
1179450979 21:41468258-41468280 GGGGCAGTCATGGGAAGTGACGG - Intronic
1179623350 21:42633051-42633073 GGGGCCGTCCTGTGCACTGTAGG + Intergenic
1180744375 22:18077771-18077793 GAAGCTGTCTTGTGAAATGGAGG - Intergenic
1181001785 22:19991173-19991195 GGGGTGGCCCTGTGAAATGGAGG - Intronic
1181284265 22:21740745-21740767 GGGGCAGTAATAGGAAATGGAGG - Intergenic
1181465284 22:23107545-23107567 AGGCAAGTCCTGTGAACTGGGGG + Intronic
1181601757 22:23956647-23956669 AGGGCAGGCTTGGGAAATGGGGG + Intergenic
1181775030 22:25153403-25153425 GGGGCCGTCCTGTGCAATGTGGG - Intronic
1181925963 22:26358876-26358898 GGGGCTGTCCTGGGCACTGGAGG - Intronic
1182259426 22:29062609-29062631 GGGGGAGGCCAGTGAAATGATGG + Intergenic
1182653129 22:31868331-31868353 GGGGCTGTCCTGTGCATTGCTGG - Intronic
1183296206 22:37030978-37031000 GGGGCCGTCCTGTGTGCTGGGGG + Intergenic
1183543977 22:38445968-38445990 GTGGCGGTCCTGTGAGCTGGGGG - Intronic
949844300 3:8354272-8354294 GGGGCTGTCCTGTGCATTGAAGG + Intergenic
949902413 3:8827868-8827890 GGGGCTGTCCTGTGCATTGTTGG - Intronic
950689263 3:14642707-14642729 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
950750226 3:15122634-15122656 GGGGCCGTCCTGTGTATTGTAGG + Intergenic
951403437 3:22263848-22263870 GGGGCTGTCCTGTGCATGGGAGG - Intronic
951606356 3:24439124-24439146 AGGGCTGTCCTGTGGCATGGAGG + Intronic
953927576 3:46990152-46990174 TGGGCAGGGCTGTGAAAAGGTGG + Intronic
954789343 3:53119660-53119682 GGGGCTGTCCTGTGCATTGTAGG - Intronic
955142702 3:56285412-56285434 GGGGCTGTCCTGTGCATTGCAGG - Intronic
955219430 3:57011537-57011559 GGGGCTGTCCTGTGCATTGGAGG - Intronic
956017982 3:64904468-64904490 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
956100053 3:65758690-65758712 GGGGCTGTCCTGTGCATTGTAGG - Intronic
956170786 3:66431878-66431900 GGGACAGTCATGTGAATTGGTGG - Intronic
956227347 3:66974713-66974735 GGGGAAGTCTTGGGAAAAGGAGG + Intergenic
956228180 3:66983150-66983172 GGGGCTGTCCTGTGTAATGTAGG + Intergenic
956232588 3:67033606-67033628 GAGGCTGTCCTGTGCACTGGCGG - Intergenic
956481347 3:69676816-69676838 GGGGCTGCCCTGTGCATTGGAGG - Intergenic
956732256 3:72207361-72207383 GCGGCTGTCCTGTGCATTGGAGG + Intergenic
956869460 3:73402502-73402524 GGGACAGTCATGAGAAATGAAGG + Intronic
959527495 3:107394081-107394103 GAGGCAATCCTGTGCAATGTAGG + Intergenic
960669766 3:120144899-120144921 GGGGGAGTCATGTGACCTGGGGG - Intergenic
961097363 3:124169216-124169238 GGGTCAGTGCTGTGATTTGGAGG + Intronic
961504758 3:127362710-127362732 GGGCCAGTCCTGTGGCAGGGAGG - Intergenic
961922423 3:130441765-130441787 GGGTCTGTCCTGTGAATTGTAGG - Intronic
963021913 3:140879998-140880020 GGGGAGGTACTTTGAAATGGTGG - Intergenic
963286144 3:143436272-143436294 GGGGCATGCCTGTGAGAAGGAGG - Intronic
964553037 3:157906205-157906227 AGGGCACTTCTGTGAAATGCTGG + Intergenic
964711099 3:159672637-159672659 GGGGCTGTCCTGTGCATTGTAGG - Intronic
965704145 3:171489059-171489081 GGGGCCTTCCTGTGCAATGTAGG - Intergenic
967906372 3:194504297-194504319 GGGGCTGTCCTGTGCACTGCAGG + Intergenic
969170121 4:5355597-5355619 GGGGCTGTCCTGTGCACTGTGGG + Intronic
969396893 4:6927662-6927684 GCGGCTGTCCTGTGCATTGGAGG + Intronic
969605027 4:8198083-8198105 GGGGCTGTCCTGTGCACTGGAGG - Intronic
969881348 4:10176785-10176807 GGGGCTGTCCTGTGCACTGTAGG + Intergenic
970263396 4:14253852-14253874 GGGGCTGTCCTGTGCAATGTAGG + Intergenic
971007290 4:22389622-22389644 TGGGCAGTCCTGGGACATGCAGG - Intronic
972471927 4:39413952-39413974 TAGGCTGTCCTGTGCAATGGAGG + Intronic
975699223 4:77046192-77046214 GGCTCAGTCCTCTGAAATGGTGG + Intergenic
976112181 4:81687601-81687623 TGGGCAGTCCTGTGAAACCTTGG + Intronic
976251066 4:83052436-83052458 GGGGCTGTCCTGTGTATTGCAGG + Intronic
976313720 4:83637391-83637413 GGGGCAGAGATCTGAAATGGCGG + Intergenic
976610509 4:87025705-87025727 GGGGCTGTCCTGTGTATTGCAGG - Intronic
976658681 4:87516585-87516607 ATGGTAGTTCTGTGAAATGGAGG - Intronic
978232921 4:106422864-106422886 GGGGCTGTCCTGTGCATTGTGGG + Intergenic
978317606 4:107457075-107457097 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
979727207 4:123976751-123976773 GAGGCTGTCCTGTAAAATAGTGG + Intergenic
982438184 4:155401571-155401593 GGGGCAGTTCTGTAAACTTGTGG + Intergenic
983646815 4:169999912-169999934 GGGTCTGTCCTGTGCAATGTAGG + Intronic
984983539 4:185305214-185305236 GGGGCTGTCCTGTGTACTGCAGG - Intronic
985024708 4:185729342-185729364 AGGGCAGTCCTCTGAAACCGGGG - Intronic
986786970 5:11123471-11123493 GGGGCAGTCCTGAGCATTGTGGG - Intronic
987819203 5:22940410-22940432 GGGGAACTCCTGTGAAAAGGTGG - Intergenic
988846892 5:35136392-35136414 GGGGCTGTCCTGTGTACTGTAGG + Intronic
990349787 5:54904373-54904395 GGGGCTGTCCTGTGCACTGTAGG - Intergenic
990891019 5:60650405-60650427 GGAGCTGTCCTGTGCACTGGGGG + Intronic
994672641 5:102780909-102780931 GGGGCTGTCCTGTGCATTGGAGG + Intronic
994975477 5:106799026-106799048 GGGGAAGTCATATGAAATGGTGG - Intergenic
995258849 5:110077798-110077820 GGAGCAGTCCTGGGCAATGTTGG - Intergenic
995355389 5:111231362-111231384 GGGGCTGTCCTGTGCACTGTAGG + Intronic
996287025 5:121805788-121805810 GGGGGAGTCTTGGGAAATGTGGG + Intergenic
996707523 5:126512588-126512610 GGGGCAGTCTTGTGGAACCGAGG - Intergenic
996808567 5:127486996-127487018 AGGGAAATCCTGTCAAATGGGGG - Intergenic
996947334 5:129086198-129086220 GGAGCTGTCCTGTGCAATGTTGG + Intergenic
997066738 5:130569086-130569108 GAGGCAGTCCTGTGCACTGTAGG - Intergenic
998212450 5:140210323-140210345 GGGGCTGTCCTGTGTATTGTAGG + Intronic
998367542 5:141640739-141640761 GGGGCAGTGCTGTCCAGTGGAGG - Exonic
998856715 5:146401106-146401128 GAGGCAGTGCTGTAAAATGACGG + Intergenic
999323050 5:150626470-150626492 GGGGCAGGCCTGGAAAGTGGGGG - Intronic
999378633 5:151104513-151104535 ATGGCAGTCCTGTGAAATTGTGG - Intronic
999423821 5:151468565-151468587 GGGGCTGTCCTGTGCATTGTGGG + Intronic
999621357 5:153477910-153477932 GGGGCTGTCCTGTGCATTGCAGG + Intergenic
999630969 5:153571100-153571122 GGGGCTGTCCTGCACAATGGAGG + Intronic
1000252660 5:159510325-159510347 GGGGCAGTTCTGGGAAACTGTGG + Intergenic
1000563002 5:162813947-162813969 GGGGCAGTCCTATGCATTGTAGG + Intergenic
1000836165 5:166156815-166156837 GCGGTAGTCCTGTGCAATGTAGG - Intergenic
1001041306 5:168337483-168337505 GGGGCTGTCCTGTGCACTGCAGG - Intronic
1001193051 5:169648205-169648227 GGGGCTGTCCTGTGCACTGTAGG + Intronic
1001831231 5:174791021-174791043 GGGGCTGTCCTGTGCATTGCGGG - Intergenic
1001850142 5:174956600-174956622 GGGGCTGTCCTGTGCATTGCAGG - Intergenic
1002051996 5:176576503-176576525 TGGGTAGTCCTGGGAACTGGGGG + Intronic
1002463596 5:179389696-179389718 GGGGCTGTCTTGTGCAATGTGGG - Intergenic
1002761370 6:205069-205091 GGGGCTGTCCTGTACAATGCAGG - Intergenic
1003055142 6:2811357-2811379 GGGGCTGTCCTGTGAGCTGTAGG + Intergenic
1006696377 6:35933839-35933861 GGGGAAGTCCTGTGGATAGGGGG - Intergenic
1006832044 6:36974553-36974575 GGGGCTGTCCTGTGTACTGTAGG + Intronic
1006943119 6:37765955-37765977 GGTGCTGGCCTGGGAAATGGGGG - Intergenic
1007688083 6:43679257-43679279 AGGGCTGTCCTGTGCAGTGGAGG - Intronic
1007746218 6:44044316-44044338 AGGGCTGTCCTGAGAAATGCCGG + Intergenic
1007984013 6:46189379-46189401 GGGGCTGTCCTGTGCACTGCAGG + Intergenic
1008034261 6:46729710-46729732 GGGGCTGTCCTGTGCATTGCAGG + Intronic
1008129694 6:47706611-47706633 GGGGCTGTCCTGTGAATTGTAGG - Intronic
1009918034 6:70020753-70020775 GGGGCAGTCCTGTACATTGTAGG - Intronic
1010688161 6:78876604-78876626 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1013067527 6:106698308-106698330 GGGACTGTCCTGTGCAATGTAGG + Intergenic
1014682311 6:124446955-124446977 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1017183516 6:151577185-151577207 GGGCCAGTCCTGTGCATTGCAGG + Intronic
1017281982 6:152636014-152636036 GGAGGAGTTCTGGGAAATGGTGG - Intronic
1018376603 6:163218949-163218971 GGGGCTGTCCTGTGCGTTGGAGG - Intronic
1019516551 7:1442670-1442692 GGGGCAGCCTGGTGCAATGGTGG - Intronic
1019564407 7:1672265-1672287 GTGGCAGTCCTGGGGCATGGTGG - Intergenic
1021416173 7:20387686-20387708 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1021470047 7:20991656-20991678 GGGGTTGTCCTGTGAATTGCAGG + Intergenic
1022132335 7:27416048-27416070 GGGGCTGTCCTGTGCATTGCAGG + Intergenic
1022626594 7:32043140-32043162 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1022633562 7:32109496-32109518 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1023255501 7:38308541-38308563 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1023878450 7:44305603-44305625 GGGGCACCCCTGTGAGGTGGGGG + Intronic
1024646360 7:51374262-51374284 GAGGCTCGCCTGTGAAATGGGGG - Intergenic
1026564634 7:71479869-71479891 GTGCTATTCCTGTGAAATGGTGG + Intronic
1027219891 7:76207012-76207034 TGGGAAGTCCTGGGAAATGGTGG - Intronic
1027772146 7:82419993-82420015 GGCGCTGTCCTGTGCAATGTAGG - Intronic
1028435939 7:90803651-90803673 GTGGCAGTTGTGTGACATGGTGG + Intronic
1028610300 7:92702893-92702915 GGGGCTGTCCTGTGTATTGTAGG + Intronic
1029550538 7:101234951-101234973 GGGGCCGTCCTGTGTACTGTGGG + Intronic
1030107517 7:105999466-105999488 GGGGTTGTCCTGTGCATTGGAGG + Intronic
1031372233 7:120982373-120982395 GGGGCTGTCCTGTAGACTGGAGG + Intergenic
1032067148 7:128780094-128780116 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1032184797 7:129715290-129715312 GGGGCTGTCCTGTGCATTGCAGG - Intronic
1032198858 7:129805167-129805189 GGGGCAGGCCTGCGGGATGGGGG + Intergenic
1033448677 7:141443662-141443684 GAGGAAGTCATGGGAAATGGGGG - Intronic
1033766278 7:144494370-144494392 GAGGCTGTCCTGTGAACTGCAGG + Intronic
1035549556 8:509934-509956 GGGGCAAACCTGAGAAGTGGAGG + Intronic
1036258873 8:7225295-7225317 GGGGCTGTCCTGTGTATTGAAGG - Intergenic
1036307747 8:7614215-7614237 GGGGCTGTCCTGTGTATTGAAGG + Intergenic
1036310928 8:7683891-7683913 GGGGCTGTCCTGTGTATTGAAGG - Intergenic
1036358601 8:8062216-8062238 GGGGCTGTCCTGTGTATTGAAGG + Intergenic
1036779853 8:11638882-11638904 GCAGCAGTCCTGTGAAATCAGGG - Intergenic
1038500272 8:28037888-28037910 GGGGCTGTCCTGTGAATTGCAGG - Intronic
1039280798 8:35981550-35981572 GGTGCAGTGCAGTGAAAAGGTGG + Intergenic
1039380027 8:37076413-37076435 AGGGCAGTCCTTTGAATTGTGGG - Intergenic
1039804682 8:40987874-40987896 GGGGCAATGATGTGGAATGGCGG - Intergenic
1041248453 8:55911663-55911685 GGGGCAGTCCTATGAGCTGCGGG + Intronic
1041354024 8:56981051-56981073 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1041734869 8:61099233-61099255 GGGGCAGTGGTGTGATCTGGTGG + Intronic
1041941237 8:63390429-63390451 GGGGCTGTCCTGTGCACTGCAGG - Intergenic
1042347250 8:67740212-67740234 AGGCCAGTCCTGGGAAAAGGGGG + Intronic
1045237542 8:100367198-100367220 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1046052032 8:109035117-109035139 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1046148277 8:110189895-110189917 GGGGCAGTGCTGGGCAATGTGGG + Intergenic
1047731131 8:127729410-127729432 GGAGCCGTCCTGTGCAATGTAGG + Intergenic
1051595068 9:18817035-18817057 GGGGCACTCCTTTGAAATATGGG - Intronic
1051854626 9:21549870-21549892 GGGGCTGTCCTGTGCATTGTGGG - Intergenic
1052898617 9:33771033-33771055 GGGGCTGTCCTGTGCATTGCAGG - Intronic
1053128525 9:35601878-35601900 GGGGCTGTCCTGTGTATTGTAGG - Intergenic
1053480635 9:38414126-38414148 GGGCCTGTCCTGTGAAGTGAGGG - Exonic
1053553838 9:39113076-39113098 GGGGCTGTCCTGTGCACTGTAGG + Intronic
1053817947 9:41933231-41933253 GGGGCTGTCCTGTGCACTGTAGG + Intronic
1054108200 9:61076893-61076915 GGGGCTGTCCTGTGCACTGTAGG + Intergenic
1054612657 9:67254232-67254254 GGGGCTGTCCTGTGCACTGTAGG - Intergenic
1054812709 9:69447452-69447474 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1054849845 9:69836344-69836366 GGGGCTGTCCTGTGCATTGCAGG + Intronic
1055106932 9:72522898-72522920 GGGGCTGTCCTGTGCACTGTAGG + Intronic
1055110758 9:72556994-72557016 GGGGCTGTCCTGTGCACTGCAGG - Intronic
1055454844 9:76462457-76462479 GGGGCTGTCCTGTGCATTGCAGG + Intronic
1055479506 9:76696010-76696032 GGGGCACTCCTGTGCACTGTAGG + Intronic
1055779202 9:79800977-79800999 GGGGCAGTCCTGTGCATTTTAGG + Intergenic
1056729720 9:89155237-89155259 GGTCCAGTCCAGTGAAATGGAGG - Intronic
1057401788 9:94729659-94729681 GGGGCTGTCCTGTGCATTGTAGG + Intronic
1059000168 9:110340477-110340499 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1059256436 9:112935480-112935502 AGGGCTGTCCTGTGCAATGTAGG + Intergenic
1059315108 9:113417647-113417669 TGAGCAGTCTAGTGAAATGGGGG + Intronic
1060406438 9:123375322-123375344 CGGCCAGTTCTGTGAAGTGGCGG + Exonic
1060949797 9:127594468-127594490 GGGGGAGTCCCTTGAAGTGGGGG + Intergenic
1061215812 9:129221428-129221450 GGGGCAGCCCTGTGCAGAGGAGG + Intergenic
1061328222 9:129876847-129876869 GGGGCCGTCCTGTGCATTGTAGG + Intronic
1061598397 9:131647885-131647907 GGGGCTGTCCTGTGTATTGTAGG + Intronic
1061805399 9:133135071-133135093 GGGGCCCTCCTGTGAACTGGAGG - Intronic
1061884965 9:133586791-133586813 GTGGCAGTCCTGAGAAAGGCAGG - Intergenic
1185582451 X:1221444-1221466 GAGGCCGTCCTGTGCATTGGGGG + Intergenic
1185587453 X:1250282-1250304 GGGGCTGTCCTGGGCACTGGTGG + Intergenic
1185832344 X:3314292-3314314 GGGGCCATCCTGTGAACTGTAGG + Intronic
1186250848 X:7664578-7664600 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1186341136 X:8647155-8647177 GGGGCAGTTCTGTGCATTGGAGG + Intronic
1186397526 X:9224863-9224885 GGGGCTGTCCTGTGCATTGCGGG + Intergenic
1186467304 X:9793696-9793718 GGGGCCATCCTGTGAATTGTAGG + Intronic
1186502590 X:10064195-10064217 GGGGCTGTCCTGTGCATTGTAGG - Intronic
1186543883 X:10428733-10428755 GGGGCCGTCCTGTGCACTGTAGG + Intergenic
1186560502 X:10607417-10607439 GGGGCTGTCCTGTGCACTGTAGG - Intronic
1186614874 X:11175765-11175787 GGGGCCGTCCTGTGCATTGTAGG - Intronic
1186651799 X:11569251-11569273 GGGGCTGTCCTGTGCATTGTGGG - Intronic
1186692563 X:11994181-11994203 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1186796157 X:13048284-13048306 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1186873951 X:13798814-13798836 GGGGCCGTCCTGTGCACTGTAGG + Intronic
1187311519 X:18148873-18148895 GTGGGATTCATGTGAAATGGTGG + Intergenic
1187339992 X:18412412-18412434 GGGGCTGTCCTGTGCACTGTAGG - Intergenic
1187452955 X:19414750-19414772 GGGGCTGTCCTGTGCATTGTGGG + Intronic
1187885597 X:23886028-23886050 GGGGCTGTCCTGTGCACTGCAGG + Intronic
1187933835 X:24317054-24317076 GGGGCTGTCCTGTGCATTGTAGG + Intergenic
1188504799 X:30870807-30870829 GGGGCTGTCCTGTGCAGTGTAGG - Intronic
1189630204 X:42944279-42944301 GGGACAGTCCTGTGAATTGTGGG + Intergenic
1190395282 X:49976025-49976047 GGGGCTGTCCTGTGCACTGTAGG - Intronic
1191642773 X:63446258-63446280 GGGACATTCCTGTGAGATAGAGG - Intergenic
1192258777 X:69490292-69490314 GGGGCTGTCCTGTGCATTGTAGG - Intergenic
1201464958 Y:14270261-14270283 TGGGAAGTCCTGAGACATGGTGG - Intergenic