ID: 1118151155

View in Genome Browser
Species Human (GRCh38)
Location 14:63192288-63192310
Sequence TGACAAAGGCTGAGCAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118151150_1118151155 12 Left 1118151150 14:63192253-63192275 CCTTTTTGATTACAGTCAGAGTT No data
Right 1118151155 14:63192288-63192310 TGACAAAGGCTGAGCAGGGCTGG No data
1118151148_1118151155 25 Left 1118151148 14:63192240-63192262 CCCTTTTCTCTTTCCTTTTTGAT No data
Right 1118151155 14:63192288-63192310 TGACAAAGGCTGAGCAGGGCTGG No data
1118151149_1118151155 24 Left 1118151149 14:63192241-63192263 CCTTTTCTCTTTCCTTTTTGATT No data
Right 1118151155 14:63192288-63192310 TGACAAAGGCTGAGCAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118151155 Original CRISPR TGACAAAGGCTGAGCAGGGC TGG Intergenic
No off target data available for this crispr