ID: 1118151488

View in Genome Browser
Species Human (GRCh38)
Location 14:63195225-63195247
Sequence CACAGGGATGGAGCTGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2918
Summary {0: 32, 1: 253, 2: 494, 3: 817, 4: 1322}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118151479_1118151488 22 Left 1118151479 14:63195180-63195202 CCAGTCCATGAAAGCAGCCAGGA 0: 24
1: 391
2: 652
3: 1042
4: 1232
Right 1118151488 14:63195225-63195247 CACAGGGATGGAGCTGCCCAAGG 0: 32
1: 253
2: 494
3: 817
4: 1322
1118151480_1118151488 17 Left 1118151480 14:63195185-63195207 CCATGAAAGCAGCCAGGAGTGAG No data
Right 1118151488 14:63195225-63195247 CACAGGGATGGAGCTGCCCAAGG 0: 32
1: 253
2: 494
3: 817
4: 1322
1118151482_1118151488 5 Left 1118151482 14:63195197-63195219 CCAGGAGTGAGGTTATACCCTGC No data
Right 1118151488 14:63195225-63195247 CACAGGGATGGAGCTGCCCAAGG 0: 32
1: 253
2: 494
3: 817
4: 1322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118151488 Original CRISPR CACAGGGATGGAGCTGCCCA AGG Intergenic
Too many off-targets to display for this crispr