ID: 1118152589

View in Genome Browser
Species Human (GRCh38)
Location 14:63205423-63205445
Sequence CTAGACACACAAATGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118152586_1118152589 -3 Left 1118152586 14:63205403-63205425 CCAAAAAAAAAGAATCACCACTA 0: 1
1: 0
2: 2
3: 48
4: 551
Right 1118152589 14:63205423-63205445 CTAGACACACAAATGGTGAAAGG 0: 1
1: 0
2: 2
3: 17
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118152589 Original CRISPR CTAGACACACAAATGGTGAA AGG Intronic
901110159 1:6786726-6786748 GTAGACACACAAATGGCGAAAGG - Intronic
902711638 1:18243927-18243949 ATAGACACAGATATGGAGAATGG - Intronic
907332872 1:53682672-53682694 CTAGATTAACCAATGGTGAAAGG - Intronic
908221126 1:62007762-62007784 GTATGCACACACATGGTGAAGGG + Intronic
912861615 1:113218722-113218744 CTACACACAGAAATGGGGGAAGG + Intergenic
914691789 1:150035770-150035792 CAAGCCACACAACTGGTGAGGGG + Intergenic
916039066 1:160946888-160946910 CCATGCACACACATGGTGAAGGG + Intronic
917601079 1:176574533-176574555 CTAGACCCACAAATAGCCAAAGG - Intronic
920955703 1:210618697-210618719 CTAGAAACATACATGGGGAAGGG - Intronic
923032624 1:230262322-230262344 CTTGTCACACAGATGGTCAAAGG - Intronic
923193111 1:231639752-231639774 CTATACACATAAATGATGACAGG - Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1063947060 10:11188038-11188060 AAAGACACACAAAAGGTGAAAGG - Intronic
1067291522 10:44946992-44947014 CTGGTCACACAGCTGGTGAAGGG - Intergenic
1073725844 10:106229567-106229589 CTATACACACAAAGAGAGAATGG - Intergenic
1073872876 10:107886299-107886321 AAAGACACACAAATGGCAAATGG + Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074641432 10:115387329-115387351 AGAGACACACAAATCTTGAAAGG - Intronic
1079525399 11:21381254-21381276 TTAGGCACAAAAATGTTGAAAGG - Intronic
1080027346 11:27628438-27628460 TTAGACACAGACTTGGTGAATGG - Intergenic
1080213489 11:29815342-29815364 CTAGACAAACAAAAGCTGAGGGG - Intergenic
1082729408 11:56776556-56776578 GTAGACACACACCTGGTGAAGGG + Intergenic
1082753563 11:57048888-57048910 CTAGAGCCACAGATGCTGAAGGG + Intergenic
1084006883 11:66327873-66327895 CTGGACACACACATGGGGACAGG - Intergenic
1084057667 11:66646939-66646961 CTAAACAAATAGATGGTGAAAGG - Intronic
1084629310 11:70335879-70335901 CCATACACACAAATGGGGCATGG - Intronic
1085466447 11:76727009-76727031 CCTGACATACAAGTGGTGAAAGG - Intergenic
1086990343 11:93296279-93296301 CTAGACAAACATATGCTGGATGG - Intergenic
1087864939 11:103213604-103213626 AAAGACACACAAATGGCCAACGG - Intronic
1088308644 11:108436918-108436940 TTAGACAAACAAAAGCTGAAGGG + Intronic
1090200369 11:124850245-124850267 GAAGACATACAAATGGTCAATGG + Intergenic
1091370498 11:135053687-135053709 CCAGAAACACAAATGGTGGAAGG - Intergenic
1092911568 12:13149726-13149748 CAAGTCACACAGATGGTTAATGG - Intergenic
1094040559 12:26116886-26116908 TTAGACACACCCATGGTGAGAGG - Intergenic
1094104521 12:26796576-26796598 CTAGAAATAGAAATGGTGAATGG - Intronic
1097885369 12:64723685-64723707 TTTAAGACACAAATGGTGAAAGG + Intronic
1099788813 12:87303501-87303523 GTAGAGACACAAATGTAGAAAGG + Intergenic
1101621084 12:106388809-106388831 ATACACACACTAATGGTGACAGG - Intronic
1103310210 12:120000288-120000310 CCAGACAATCAAATGGTGACTGG - Intronic
1104151918 12:126091873-126091895 GCAGACACAAAAATGGAGAAAGG - Intergenic
1105614989 13:22003598-22003620 CTAGAACCACAAATGCTCAATGG + Intergenic
1108131257 13:47303000-47303022 CTAGTGACACACATGGTTAAGGG + Intergenic
1108647268 13:52442825-52442847 GCAGACACACAAGTAGTGAAAGG + Intronic
1109112305 13:58336853-58336875 GTAGACACACAAAGGGCAAATGG - Intergenic
1109386396 13:61633887-61633909 CTAGACACTCCATAGGTGAAGGG + Intergenic
1110329359 13:74253108-74253130 CTAGAAATACAGATGATGAATGG - Intergenic
1111010893 13:82313244-82313266 GAAGACATACAAATGGTGATAGG + Intergenic
1112763508 13:102716953-102716975 CAAAACACACAAATTGTGAGGGG + Intergenic
1114367707 14:22047767-22047789 CTAGGCACACACATGGAGAATGG + Intergenic
1116138835 14:40961811-40961833 GTAGAAACCCAACTGGTGAATGG + Intergenic
1116713974 14:48405400-48405422 CAAGATACACAAATGGCCAATGG - Intergenic
1118152589 14:63205423-63205445 CTAGACACACAAATGGTGAAAGG + Intronic
1119577137 14:75735187-75735209 CTTGGCACACAAATCCTGAATGG - Exonic
1120399282 14:84007713-84007735 GTAGGGAGACAAATGGTGAAAGG - Intergenic
1121049972 14:90814060-90814082 CTAGAGACTCACATGGTGAGTGG - Intronic
1121180341 14:91924218-91924240 CTCAACACATAAATGGTAAATGG + Intronic
1121241247 14:92431505-92431527 CTAGACACTGGCATGGTGAAGGG - Intronic
1121346882 14:93142775-93142797 CTAAAAACACAAAAGATGAAAGG + Intergenic
1121945069 14:98112383-98112405 CTAGACACCAATATGGTGCATGG - Intergenic
1124682270 15:31743474-31743496 CTAAACACATAAATGAGGAATGG + Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1128461672 15:67873498-67873520 CAAAACACACAAATGATAAAGGG + Intergenic
1130789867 15:87142740-87142762 CATGACTCACAGATGGTGAAAGG + Intergenic
1131431108 15:92390074-92390096 ATAGTCTCACAAATGATGAAGGG + Intergenic
1131814017 15:96203679-96203701 TTATAAACATAAATGGTGAAAGG + Intergenic
1135859225 16:26039989-26040011 CTAGACACCTAAATGGGAAATGG + Intronic
1135907011 16:26521453-26521475 ATAAAAACAAAAATGGTGAATGG - Intergenic
1138905653 16:61328226-61328248 GAAGACACACAAATGGCAAATGG - Intergenic
1139251468 16:65500506-65500528 CCAGACACACAAAGCATGAAGGG + Intergenic
1140956352 16:79870075-79870097 CCAGACACAGAAAAAGTGAATGG - Intergenic
1141268462 16:82518186-82518208 CTAGATCCACAAATGGCTAAAGG - Intergenic
1143487400 17:7262344-7262366 CTAGGCAAACAAAAGGTGGAGGG + Exonic
1144791114 17:17859961-17859983 CCACACACACAAAGGGTGAAGGG + Intronic
1146046014 17:29507873-29507895 CTAGACATACAAATAATGTAAGG - Intronic
1146594869 17:34159563-34159585 CAAAACAAACAAATGGCGAAGGG - Intronic
1148186648 17:45649382-45649404 CTGGTCACACAAATGCTAAACGG - Intergenic
1148858043 17:50589857-50589879 CCAGTCACACACATGGTGATAGG - Intronic
1149092492 17:52801016-52801038 GAAGACACACAAATGGCCAACGG - Intergenic
1150897632 17:69232757-69232779 CTAGACACACAAAAGCTGAGGGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153530939 18:6045035-6045057 CTAGTCAGAAAAATGGAGAAAGG - Intronic
1155103084 18:22633203-22633225 CTAGACAAAAATATGGGGAAAGG - Intergenic
1157929140 18:51801290-51801312 GTAGACACACAAAAGATAAAAGG - Intergenic
1158156014 18:54426249-54426271 CTAGATAAACAAATAGTCAAGGG - Intergenic
1159508350 18:69363997-69364019 CAAAACACACAAAAGGTTAAAGG - Intergenic
1163850699 19:19661657-19661679 TAAGACACAGAAATGTTGAATGG + Intronic
1166353291 19:42211371-42211393 CTAGACCCTCAAAGGGAGAAGGG + Intronic
1168307832 19:55445157-55445179 CTAGACACACACACGATGGATGG - Intergenic
925648089 2:6058075-6058097 CAAGACATACAAATGGCCAATGG - Intergenic
927848800 2:26486075-26486097 ATAGACGGACAGATGGTGAATGG + Intronic
929115002 2:38436570-38436592 CTAGACACCAAAATGGAGCAAGG - Intergenic
930288616 2:49466039-49466061 CCAGACAAACAAAAGGTGAGGGG - Intergenic
932518333 2:72378421-72378443 CCAGACAGAAAAATGGAGAATGG + Intronic
932530054 2:72520605-72520627 ATAGCCAGATAAATGGTGAATGG - Intronic
933053576 2:77632605-77632627 CCAGACAAACAAAAGCTGAAAGG - Intergenic
936389635 2:112059402-112059424 CTAGATGAACAAAGGGTGAAAGG + Intronic
937427408 2:121811864-121811886 CCAGACCCACAAAGGGTGTAAGG - Intergenic
938976074 2:136480060-136480082 TTACACTCACAAATGGTGCATGG + Intergenic
939178103 2:138773508-138773530 CTACACACACAAATGAGGAATGG + Intronic
939763555 2:146216108-146216130 CTAGAATCAGAAATGGAGAATGG + Intergenic
940433241 2:153619643-153619665 CCAGACAAACAAAAGCTGAAGGG - Intergenic
940693618 2:156951469-156951491 GTAGACAGACAAAAGGAGAATGG - Intergenic
944457861 2:199914221-199914243 CTAGATACATAAATGTTGAGGGG - Intronic
945984712 2:216344399-216344421 CATGACTCACAAATGGGGAAGGG + Intronic
946430539 2:219624874-219624896 GTAGACACTGAAATGGTGACAGG - Intergenic
948132376 2:235610093-235610115 CTAGTCACAGATATGGTGACAGG + Intronic
948559336 2:238840728-238840750 CTAGAAACATGAATGCTGAAAGG + Intergenic
1170956966 20:20990329-20990351 CTAGAACCAAAAATGGAGAAAGG - Intergenic
1171197599 20:23212457-23212479 CTAGATAATCAAATAGTGAAGGG - Intergenic
1171867139 20:30495207-30495229 TGAAACACACAAATGGTGATTGG + Intergenic
1172707038 20:36889463-36889485 TTTGAAACACAGATGGTGAAGGG + Intronic
1173988382 20:47280408-47280430 CTAAACACACAAATGGTTTTGGG + Intronic
1175209907 20:57347422-57347444 CTAGAAACAAAAAGGGAGAACGG - Intergenic
1175536253 20:59716195-59716217 ACACACACACAAAGGGTGAAGGG - Intronic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1178592727 21:33924975-33924997 CAAGTCACACAGCTGGTGAAGGG - Intergenic
1179228957 21:39483123-39483145 AAAGACACACAAATGGCAAATGG + Intronic
1180659417 22:17453000-17453022 ATAGACACACAAATGTTTATCGG + Intronic
1185386229 22:50532350-50532372 CTAGACCCAGACTTGGTGAAGGG + Intronic
950760443 3:15219287-15219309 GTAGACACACAAAAAATGAAAGG + Intronic
951303892 3:21034138-21034160 CAAGACATACAAATGGCCAATGG - Intergenic
952549344 3:34458390-34458412 AAAGACACACAAAGGGTGAAAGG - Intergenic
952912851 3:38205195-38205217 TTAGAGACACTAATGGTGATAGG - Intronic
953170565 3:40503053-40503075 CAAGACACACACATGGAGCAGGG - Intergenic
953547085 3:43871616-43871638 ATGGGCACAAAAATGGTGAAGGG + Intergenic
956345576 3:68274345-68274367 CTAGACAGAAAAATGTTGGATGG - Intronic
957459652 3:80500086-80500108 CTAGAAAGACAAAGAGTGAAAGG + Intergenic
958778813 3:98517148-98517170 CTAAACTCACAAAAGGTAAAAGG + Exonic
960210995 3:114965783-114965805 GAAGACATACAAATGGTTAATGG - Intronic
960346198 3:116536201-116536223 CCAGCCACACAGATGTTGAAAGG - Intronic
960864799 3:122188533-122188555 TCAGACACAGAAATGGTCAAGGG - Intronic
961367352 3:126408526-126408548 GCAGACACACAAATGCAGAATGG - Intronic
963380407 3:144522853-144522875 CTGAAAACAAAAATGGTGAAAGG + Intergenic
963623134 3:147636806-147636828 TTAGACAAACAAATGCTGACAGG + Intergenic
965434602 3:168633524-168633546 ATTGACACACATAAGGTGAAGGG - Intergenic
965499320 3:169438652-169438674 ATATGCACAGAAATGGTGAAGGG + Intronic
966579355 3:181542326-181542348 CAAGACACACAATTAGTGAATGG + Intergenic
967182526 3:186918846-186918868 CTACATACACAAAAGGAGAAAGG - Intergenic
968617723 4:1587015-1587037 GAAGACACACAAATGGCCAACGG - Intergenic
972883396 4:43454070-43454092 GTACATACACAAATGCTGAATGG + Intergenic
975020324 4:69479005-69479027 GAAGATATACAAATGGTGAATGG + Intergenic
978968738 4:114775510-114775532 GTAGACAGACAAATGGCAAACGG - Intergenic
981285473 4:143013308-143013330 GAAGACATGCAAATGGTGAACGG - Intergenic
984172137 4:176372325-176372347 CTAAAGACACAAATAGTAAAGGG - Intergenic
984581492 4:181515534-181515556 CGAGTCCCAAAAATGGTGAAAGG + Intergenic
985108099 4:186518989-186519011 TTAGACAAACAAATGCTGAGAGG - Intronic
986980640 5:13444695-13444717 ATAGATACACAAATATTGAACGG - Intergenic
987616715 5:20283464-20283486 GAAGACACACAAATGGAAAACGG + Intronic
988024670 5:25669674-25669696 GTAGACATGCTAATGGTGAATGG + Intergenic
988315168 5:29617049-29617071 CAGCACACACAAAGGGTGAAAGG + Intergenic
989370925 5:40706963-40706985 CCAGACAAACAAATGCTGAGAGG + Intergenic
991499809 5:67265934-67265956 CTGAACACACATGTGGTGAATGG + Intergenic
993238937 5:85354104-85354126 CTAAGCACACAACTGGGGAAGGG - Intergenic
993541057 5:89152292-89152314 CAAGACATACAAATGGCCAATGG - Intergenic
993552195 5:89287214-89287236 CTGGACACACAAAGGGTTATTGG + Intergenic
994384125 5:99108355-99108377 ACACACACACAAATGCTGAAAGG - Intergenic
994686737 5:102964355-102964377 GTAGACAAAGATATGGTGAAAGG - Intronic
994813488 5:104554405-104554427 CAAGACACACAAATGGCAAACGG + Intergenic
995176095 5:109179302-109179324 TTACACACTTAAATGGTGAAAGG - Intronic
995749267 5:115437201-115437223 ATATACACACACATGGGGAATGG + Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
1003480882 6:6532012-6532034 ATAGGCACAGAAATGGAGAATGG - Intergenic
1003497062 6:6673422-6673444 CTAGACAGACAGATGGGGCAGGG - Intergenic
1006023648 6:31133143-31133165 GTAGGCACAAAAATGGTAAAGGG + Intronic
1006050537 6:31339544-31339566 CAAGACAAGCAAATGCTGAAAGG - Intronic
1006952819 6:37839083-37839105 GTAGATACACAAATGGTCAATGG - Intronic
1007840943 6:44715450-44715472 CCAGACACACCGATGGTGACAGG + Intergenic
1008847718 6:55988014-55988036 GAAGACATACAAATGGTAAACGG - Intergenic
1012225373 6:96697616-96697638 GAAGACACACAAATGGAAAATGG + Intergenic
1015481729 6:133719185-133719207 TTAGCCAAACAAATGGAGAAAGG + Intergenic
1017461793 6:154657963-154657985 GAAGACATACAAATGGCGAACGG - Intergenic
1017985298 6:159438324-159438346 CCAGACAGACACATGGTGAGAGG + Intergenic
1020979459 7:15049942-15049964 CTATACACAGAAAGCGTGAAAGG + Intergenic
1022362921 7:29680123-29680145 CTAGAGACTCAACTGGGGAAAGG - Intergenic
1023355100 7:39358635-39358657 ATACACAAACAAATGGTTAATGG + Intronic
1023869608 7:44255980-44256002 CTGGACAGAAAAATGGGGAAAGG - Intronic
1024894937 7:54247186-54247208 CTAGACACACACATGATGAAAGG - Intergenic
1025251726 7:57355831-57355853 CAAGACACACAGATGATTAAAGG + Intergenic
1028631522 7:92939838-92939860 CCAGAGACACATATGGAGAAAGG - Intergenic
1028656139 7:93209552-93209574 ATAGACACAAAAATAGTTAATGG - Intronic
1028909551 7:96192599-96192621 CTCGACACATACACGGTGAAAGG + Intronic
1028926367 7:96360924-96360946 CTATACACATAAATGGAGCAGGG + Intergenic
1029008959 7:97238734-97238756 ATAGACACAAAAATGATAAAGGG + Intergenic
1030552979 7:110987986-110988008 TTAGAAAAACAAATGGAGAAAGG + Intronic
1031754137 7:125616638-125616660 CTAGACAACCAAATGCTGAGGGG - Intergenic
1037044611 8:14282794-14282816 CTAGAAAAACAAATATTGAAAGG - Intronic
1041548545 8:59075157-59075179 CTAATGACAAAAATGGTGAAAGG + Intronic
1043517020 8:81004133-81004155 CAAAACACACAGATGGTGCACGG + Intronic
1044032726 8:87258363-87258385 CTACACACACAAATAAAGAAGGG - Intronic
1045937576 8:107698631-107698653 GTATAAACACAAATGGTGAAAGG + Intergenic
1046147831 8:110185064-110185086 CTAAACTCAAAAATTGTGAATGG - Intergenic
1046266680 8:111839421-111839443 CAAGACAGACCACTGGTGAAAGG + Intergenic
1046610362 8:116416657-116416679 ATTGACACACAACTGGTAAACGG + Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047148004 8:122227299-122227321 TTGGACAAACAAATGCTGAAGGG + Intergenic
1048951277 8:139498909-139498931 CTACACACACAGATGGGGCAAGG - Intergenic
1049946876 9:605631-605653 CAAGAGACCCAAATGATGAATGG + Intronic
1050023374 9:1308132-1308154 CCAGACACCCAAATGCTGACAGG - Intergenic
1052240050 9:26260959-26260981 CTACACAGACAAAGGGTGAAGGG + Intergenic
1054887087 9:70210837-70210859 ATAGACAAACAAATGCTGAGAGG - Intronic
1057095479 9:92304235-92304257 CTAGACAGACAAATGTTGGAAGG - Intronic
1186710045 X:12184398-12184420 CCAGTCACACACATGCTGAAAGG + Intronic
1188439844 X:30205180-30205202 AGAGTCACACAAATGGTGGAGGG - Intergenic
1189769033 X:44403991-44404013 GAAGACACACAAATGGCCAACGG - Intergenic
1194525606 X:94973305-94973327 CTGGACACAGAAATGGGCAAAGG - Intergenic
1195441142 X:104899707-104899729 CTAGGCACAGAAATGGTTTATGG - Intronic
1197139798 X:123104838-123104860 GAAGACATACAAATGGTGAAAGG + Intergenic
1198938718 X:141929644-141929666 CCAGACAAACAAAAGCTGAAGGG - Intergenic
1199062236 X:143372036-143372058 CTAATCACACATCTGGTGAATGG + Intergenic
1199418981 X:147620951-147620973 GAAGACATACAAATGGTAAATGG + Intergenic
1199744432 X:150762836-150762858 CTAGCCACACAAATGGTCCCTGG - Intronic