ID: 1118153432

View in Genome Browser
Species Human (GRCh38)
Location 14:63214378-63214400
Sequence GCACCATTACAGCATAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118153432_1118153433 -3 Left 1118153432 14:63214378-63214400 CCTTCTTTATGCTGTAATGGTGC 0: 1
1: 0
2: 1
3: 9
4: 118
Right 1118153433 14:63214398-63214420 TGCCTATGAATCAAGCCAAAAGG 0: 1
1: 0
2: 0
3: 8
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118153432 Original CRISPR GCACCATTACAGCATAAAGA AGG (reversed) Intronic
900709783 1:4106484-4106506 CCAGCATTACAGCTGAAAGAGGG + Intergenic
906701147 1:47859138-47859160 GCACCATGCCAGCCTCAAGAGGG - Intronic
908828926 1:68160338-68160360 CCACCATTACAACTTAAGGACGG + Intronic
913379636 1:118195158-118195180 GAACCATGGGAGCATAAAGAAGG - Intergenic
921133529 1:212239770-212239792 GCAGCAATACAGCATAAGTAGGG - Intergenic
922469604 1:225867848-225867870 GCCCCATTACAACATAGACAAGG + Intronic
1063717992 10:8548032-8548054 ATACAATTATAGCATAAAGATGG - Intergenic
1073906173 10:108282574-108282596 GCACCACTACAGCCTTAAGCAGG + Intergenic
1077860619 11:6175540-6175562 GCAGCATGACAGCATAGAGTGGG - Intergenic
1079925963 11:26491521-26491543 GAAACATCTCAGCATAAAGAAGG + Intronic
1080281209 11:30558897-30558919 GGACAATTACAGCCAAAAGAAGG + Intronic
1084902959 11:72323674-72323696 GGACCATTCCAGATTAAAGAAGG + Intronic
1085754065 11:79189477-79189499 GCACCATGTCAGCATACAGTAGG + Intronic
1086413120 11:86561954-86561976 AGAACTTTACAGCATAAAGAAGG - Intronic
1090346119 11:126072556-126072578 GCGCCAGTTCAGCATAAAAAAGG - Intergenic
1092640394 12:10501575-10501597 GCACCATGAGAGGATAGAGATGG + Intergenic
1093500853 12:19810272-19810294 GCAGCATTCCAGAACAAAGATGG - Intergenic
1095673159 12:44884765-44884787 GCACATTTACAACCTAAAGAAGG + Intronic
1095923464 12:47554875-47554897 GCAGCACTATAGCAAAAAGATGG + Intergenic
1099424111 12:82501703-82501725 GTACAGTTAGAGCATAAAGAAGG + Intergenic
1107809546 13:44187320-44187342 ACACCATAACATCATCAAGAAGG + Intergenic
1107845437 13:44507876-44507898 GCACTACGACAGCACAAAGAGGG + Intronic
1108295234 13:49010222-49010244 TCACCCTTACAGCCCAAAGATGG - Intronic
1108434727 13:50390413-50390435 GCACCACGACAGCATAATTATGG - Intronic
1114521691 14:23342730-23342752 GCACCATGACAAAATAAAAATGG + Intergenic
1118153432 14:63214378-63214400 GCACCATTACAGCATAAAGAAGG - Intronic
1118343925 14:64920310-64920332 AGACCATAACAGCTTAAAGAAGG - Intronic
1119381332 14:74230843-74230865 CCAACATTAGAGCAGAAAGAAGG - Intergenic
1130334268 15:82945575-82945597 GAAAAATAACAGCATAAAGAAGG - Intronic
1132377816 15:101342230-101342252 ACACCATTACAGCACAAATGAGG + Intronic
1143947360 17:10605074-10605096 GCACTATTACTCCAGAAAGAGGG - Intergenic
1147672068 17:42182064-42182086 GAACCAGTACAGCAGCAAGAGGG + Intergenic
1150387150 17:64771223-64771245 GCACTATAATAGGATAAAGAGGG + Intergenic
1156506899 18:37602140-37602162 GCACTATAATAGCAAAAAGATGG - Intergenic
1156848241 18:41694970-41694992 GCACAATTAGAGAAAAAAGATGG - Intergenic
1157100547 18:44725193-44725215 GAACAATAACAGCATCAAGATGG - Intronic
1159159172 18:64621428-64621450 GCTCCCTTACAGCATATAGCAGG + Intergenic
1159701981 18:71640580-71640602 GCCCCATGACAGCATACAGGTGG + Intergenic
1165599366 19:37040225-37040247 GCACTATTATATCATAGAGATGG + Intronic
926423982 2:12724756-12724778 GAGCCAATACAGCATACAGAAGG - Intronic
931163881 2:59724397-59724419 TCACCCTAACAGCATTAAGAAGG + Intergenic
935389598 2:102536464-102536486 GCAGCATCACAGCATCAAGGGGG - Intergenic
936470299 2:112792645-112792667 GCACCATGACAGTTTACAGATGG + Intergenic
938588351 2:132713650-132713672 GAAACATTACAGAATAAAAAGGG + Intronic
941307374 2:163887753-163887775 GCTGCATTACAGTATTAAGATGG + Intergenic
943610542 2:190028659-190028681 GAAACATTCCAGCATAAAAATGG + Intronic
1169526302 20:6429815-6429837 GCAGCATTTCAGCAGAAATAAGG + Intergenic
1176788972 21:13295725-13295747 GCACCATTATAGTATAATTATGG + Intergenic
1177645677 21:23897687-23897709 ACACAATTACAGAAGAAAGAAGG + Intergenic
1177968750 21:27761629-27761651 GCACTATTGCAGGAGAAAGAGGG - Intergenic
1178481407 21:32982675-32982697 GCACCATTTCAGCAGAGACAGGG + Intergenic
1179550631 21:42141379-42141401 GGACCCTTACAGCATAGACAGGG + Intronic
1180390964 22:12281388-12281410 TCACCATTAAATCATAATGACGG - Intergenic
1180408778 22:12583369-12583391 TCACCATTAAATCATAATGACGG + Intergenic
949285452 3:2397609-2397631 TCAGCATTGCAGTATAAAGAAGG + Intronic
949514021 3:4791203-4791225 GCTACATTATAGCAAAAAGAAGG - Intronic
950857779 3:16121474-16121496 GCACCATCACAGCAAAAGAAAGG - Intergenic
953159265 3:40403323-40403345 GCACTATTATAGCAGAAAGTGGG + Intronic
955728323 3:61956840-61956862 GTACTATTCCAGGATAAAGAGGG - Intronic
955868106 3:63407206-63407228 GAACCATTACAGCATAGACCAGG + Intronic
955899863 3:63740952-63740974 GCACTATTTAAGCATAAAGTAGG - Intergenic
956152341 3:66257043-66257065 GCACCCTGACAGCAAGAAGATGG - Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
959466555 3:106694447-106694469 GTACCATTTCACCATAAAGATGG - Intergenic
959737613 3:109677804-109677826 GAACCATGACAGCACATAGAAGG + Intergenic
960873396 3:122273697-122273719 GCACGATTACAGCATGGAGAAGG + Intronic
966213606 3:177478326-177478348 GCACTATTACAGTCTAAAGAGGG - Intergenic
967153846 3:186674646-186674668 GCATCTGTATAGCATAAAGATGG - Intronic
967157420 3:186706149-186706171 GCACCCATATAGCATAAAGATGG - Intergenic
967158498 3:186714761-186714783 GGAACTATACAGCATAAAGATGG - Intergenic
970464445 4:16308630-16308652 GAAACTTTACAGCATACAGAGGG - Intergenic
970715530 4:18917801-18917823 ACACCATTACATAATAAAAAAGG + Intergenic
972929674 4:44056441-44056463 TCTCCCTTACACCATAAAGAGGG + Intergenic
973827581 4:54724105-54724127 GCACAATTACAACATACATATGG + Intronic
977592289 4:98840730-98840752 GCACTTCTACAGCATCAAGAAGG - Intergenic
979477016 4:121170113-121170135 GCACCATGAGATCATAAAGAAGG - Intronic
980873994 4:138642096-138642118 GCACCATTGCAGTAAAAAGAAGG - Intergenic
987962106 5:24823930-24823952 GCACCATGACAGCATCCAGTGGG + Intergenic
990385954 5:55262794-55262816 CCACCAGTACAGCTTTAAGAAGG + Exonic
993748239 5:91629646-91629668 TCACCATTAAAGAAGAAAGAAGG + Intergenic
994125027 5:96159286-96159308 GCACCATCCCAGCATGAGGAGGG - Intergenic
995004901 5:107180752-107180774 TCACCATGACAACATCAAGAGGG + Intergenic
995584946 5:113639041-113639063 TCACCTTTAAAGCATAAAAATGG + Intergenic
995916292 5:117249115-117249137 GCACCAGTACAGGAGAAAGGGGG - Intergenic
996766956 5:127044211-127044233 ATACCATTTCAGCATAAAGAAGG + Exonic
997755386 5:136392239-136392261 GTAACATTAAAGCAAAAAGAAGG - Intronic
998898287 5:146823886-146823908 GGACCATTACAGCATAAGTTTGG - Intronic
998967085 5:147552571-147552593 TCTCCATTACAGTATAAGGAGGG - Intergenic
999892004 5:155988254-155988276 GCGCTTTTAAAGCATAAAGAAGG + Intronic
1002543090 5:179919324-179919346 GCCCCAGCACAGCATGAAGAAGG - Intronic
1008393483 6:50979932-50979954 GCATCATCACAGCATCAAGGTGG + Intergenic
1010153715 6:72766895-72766917 GTGTCATCACAGCATAAAGATGG + Intronic
1010868619 6:81010823-81010845 GCCTCATTACAGCATGATGAGGG + Intergenic
1012150013 6:95737296-95737318 GCACCATGAAAGCATTAATATGG + Intergenic
1012743729 6:103055277-103055299 GCAACATTCCAGCAGGAAGATGG + Intergenic
1013807138 6:114008542-114008564 GCACCATTACAGAATTTACAGGG + Intronic
1014229252 6:118884283-118884305 TAACAATTACAGCATAAAAAGGG + Intronic
1015911204 6:138169189-138169211 GCACCATGGAAGCATCAAGAAGG - Intronic
1018442284 6:163824286-163824308 GTACCATTACTGCACAAATAAGG - Intergenic
1022276430 7:28859588-28859610 GTACCATTACACCAAAAATATGG + Intergenic
1022736279 7:33079201-33079223 GCACAATTACAGAAGAAAAATGG - Intergenic
1023431514 7:40096385-40096407 ACACCATTACAGTTTAAATAAGG - Exonic
1023912267 7:44564472-44564494 GCACGAATACAGCATAAGGCTGG + Intergenic
1032454265 7:132060208-132060230 AGACCATAACAGCCTAAAGAGGG + Intergenic
1032602935 7:133318929-133318951 GCAACATTACATCAGAAAGAGGG - Intronic
1034018371 7:147611625-147611647 TCACAATTACAGCCCAAAGATGG - Intronic
1034260526 7:149752667-149752689 GAACCATGACAGCTTAAAGGAGG + Intergenic
1035177831 7:157064960-157064982 GCATCATTTGAGCAGAAAGATGG - Intergenic
1037963155 8:23114996-23115018 GGATCATTAGAGCATAGAGAAGG + Intronic
1037967865 8:23147552-23147574 GCATCATTACAGCATAGAGGAGG - Intronic
1037974951 8:23202405-23202427 GCATCATTACAGCACAAAGAAGG - Intronic
1042671909 8:71273373-71273395 GAACCATTACAACATAATGCTGG + Intronic
1044005700 8:86934185-86934207 GTACCATTACAATATAAAAATGG - Intronic
1048061813 8:130926910-130926932 ATACTATTACACCATAAAGAAGG - Intronic
1050446800 9:5731892-5731914 TAACCATTACACTATAAAGAAGG + Intronic
1058337829 9:103854767-103854789 ACACCCTTACAGCCTAAGGAAGG - Intergenic
1058579995 9:106445582-106445604 CCACCATTTCAACATAAATAAGG + Intergenic
1060438285 9:123615217-123615239 TCACCATAGCAGCATAAGGAGGG + Intronic
1185863727 X:3603979-3604001 GCACAATTACAGCTCAAAGCAGG + Intergenic
1186157339 X:6739223-6739245 GCACGATTTCAGCAAAAAGCAGG - Intergenic
1186640988 X:11455285-11455307 GAACCATTATTGCAAAAAGAAGG - Intronic
1188213589 X:27451590-27451612 GCACAAGTAAAGCAGAAAGAGGG + Intergenic
1192005949 X:67212569-67212591 ACACCATTACAGGAGAAAGTTGG - Intergenic
1197414940 X:126164453-126164475 GCACAAATGCAGCATGAAGAAGG + Intergenic
1198107710 X:133477125-133477147 AGACGATTACAGCACAAAGATGG + Intergenic
1198954200 X:142109597-142109619 GCTCCCTTACAGAATAAAAATGG - Intergenic
1199654549 X:149981361-149981383 GGACCATTACTGCTTTAAGAGGG + Intergenic
1200843115 Y:7803899-7803921 GAAGCATTACAACATAAAGGTGG - Intergenic
1201927479 Y:19303912-19303934 GCACCCTTACAGACAAAAGATGG - Intergenic