ID: 1118154770

View in Genome Browser
Species Human (GRCh38)
Location 14:63228876-63228898
Sequence GCTTCTGGAAGAAACTCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118154770_1118154773 -2 Left 1118154770 14:63228876-63228898 CCTTCCGAGTTTCTTCCAGAAGC 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1118154773 14:63228897-63228919 GCCTTCCAGAGCCCTCAGTGAGG 0: 1
1: 0
2: 5
3: 20
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118154770 Original CRISPR GCTTCTGGAAGAAACTCGGA AGG (reversed) Intronic
910008275 1:82427364-82427386 CCTTCTGGAAGAAAATATGAAGG - Intergenic
916532363 1:165669327-165669349 CCTTCTGGAAGATACAAGGATGG - Exonic
916684774 1:167134591-167134613 GCTCCTAGAAGAACCTTGGAGGG + Intergenic
919728131 1:200896891-200896913 GCTCCAGACAGAAACTCGGAAGG + Intronic
922340084 1:224648013-224648035 GGTTCTGGAGGAACCTGGGATGG + Intronic
922918551 1:229279268-229279290 GCTTGGGGAAAAAACTAGGAAGG + Intronic
923125181 1:231028294-231028316 GCTCCTGGAGGAAACTTGGTTGG - Intronic
924663187 1:246041720-246041742 GGTTCTGGAAGAGAATTGGAGGG + Intronic
1064665347 10:17644685-17644707 GCTTCTGGAAGAACAGCGAAGGG + Intronic
1066239470 10:33519198-33519220 GCTTTAGGAAGAAACTCTCACGG - Intergenic
1068193909 10:53690755-53690777 GCATCTGGCAGAAAGTCAGAAGG + Intergenic
1068280975 10:54869276-54869298 GTATCTGGAAGAAACTAAGAAGG + Intronic
1071465737 10:85938090-85938112 ACCTCTGGAAGAAACTCTGTTGG - Intronic
1071969035 10:90883858-90883880 GCTTCTGGAAAAAATGGGGAAGG - Intronic
1073338669 10:102729236-102729258 GCTTCAGGGAGAAAGTCGGCTGG - Intronic
1074888919 10:117719001-117719023 GCTACTGGAAGCACCTTGGAGGG - Intergenic
1075446367 10:122516191-122516213 TCTTCTGGAAGAAACTAGCCTGG + Intergenic
1076452592 10:130567066-130567088 GTTTCTGGAAGTAACCTGGAAGG - Intergenic
1078561617 11:12377730-12377752 CCTTCTTGGGGAAACTCGGAGGG + Exonic
1080041537 11:27764306-27764328 GTTTCTGGAAGGTACTCAGAAGG - Intergenic
1087877859 11:103379488-103379510 GCTTTGGGAAGAAAATGGGAGGG - Intronic
1088474815 11:110224247-110224269 GCTTTTAGAAGAAATTCGAAGGG - Intronic
1090147672 11:124342963-124342985 GCTCCTGGAGTAAACTCTGAAGG + Intergenic
1095880405 12:47129779-47129801 GCGTCTGGCAGGAACTCCGAGGG + Intronic
1097504445 12:60447610-60447632 GCTTCTGGGAAAAAATAGGATGG - Intergenic
1101569986 12:105944988-105945010 TCTTCTAGAAGAAACTCCAAAGG + Intergenic
1102666724 12:114580666-114580688 GCTTCTGGAACATTCTAGGAAGG + Intergenic
1112918320 13:104578408-104578430 GCATCTAGAAGTAACTTGGAAGG + Intergenic
1116204077 14:41838595-41838617 GGTTTTGAAAGAAACTCAGATGG + Intronic
1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG + Intronic
1118154770 14:63228876-63228898 GCTTCTGGAAGAAACTCGGAAGG - Intronic
1118802077 14:69199787-69199809 CCTTCTGGAATAACTTCGGAAGG + Intronic
1118884301 14:69853663-69853685 GCTTCTGGAAGAACCCAGGATGG - Intergenic
1121234019 14:92379461-92379483 GCTGCTGGAATAATCTAGGAGGG + Intronic
1125113165 15:36057555-36057577 GCTTCTGGAGGGAACTCAGTTGG + Intergenic
1126255708 15:46622866-46622888 GCTTTTGGAAGAAACTGTCAGGG - Intergenic
1127683774 15:61322079-61322101 GCTTCTGAGAGAAACTGGTAAGG + Intergenic
1128737620 15:70062107-70062129 GCTTCGGGCAGAAACTTGGCCGG - Intronic
1135394238 16:22118928-22118950 GCTCCTGGCAGAAATTCAGAAGG + Exonic
1135787398 16:25362336-25362358 GCTTCTGCAGGAAGCTGGGAGGG + Intergenic
1137835526 16:51588889-51588911 GTTTCTGGATGAAACTTGCAAGG + Intergenic
1138177891 16:54918405-54918427 GCTTAGGGAAGGAACTGGGAAGG - Intergenic
1139548073 16:67659041-67659063 GCTTCTGGATGAAATGCGGGAGG - Exonic
1141342193 16:83213417-83213439 CCTTCTAGAAGAAACAAGGAGGG - Intronic
1141432288 16:83976489-83976511 GCTTGCCGAAGACACTCGGAAGG + Intronic
1141727926 16:85802000-85802022 GCTTCTGGAGGAAACTCTCCAGG + Intronic
1150287828 17:63963890-63963912 GACTCTGGAAGAAGCTCTGAGGG - Intronic
1150937420 17:69651966-69651988 GCTTTTGGAAGAAAAGTGGAGGG + Intergenic
1152615925 17:81337735-81337757 GCATCTGGTTGAAACTCGGGAGG + Intergenic
1154119395 18:11639131-11639153 TCTTCTGTAAGAAACTCAAAAGG - Intergenic
1154359075 18:13643944-13643966 TCTCCTAGAAGAAACTGGGATGG + Intronic
1161668858 19:5593268-5593290 GCTTTTGCAAGAAACTCAGAGGG - Intronic
1166743432 19:45128214-45128236 CCTTCTGGAAGGATCTCTGATGG + Intronic
927879393 2:26679958-26679980 GCTTCTGGGAGAAACAGGCAGGG + Intergenic
929613917 2:43293176-43293198 GCTTCTGGGAGGAAGTCAGAGGG - Exonic
932790613 2:74651771-74651793 GCTAGAGGAAGAAACTCAGACGG + Intergenic
932933485 2:76073232-76073254 CATTAGGGAAGAAACTCGGATGG - Intergenic
934477823 2:94604670-94604692 GCTCCTGGAAGAACCCAGGAGGG - Intergenic
934793115 2:97079959-97079981 GCATCTGTAAGAAACTTGGCTGG - Intergenic
934813075 2:97300584-97300606 GCATCTGTAAGAAACTTGGCTGG + Intergenic
934824620 2:97407896-97407918 GCATCTGTAAGAAACTTGGCTGG - Intergenic
935110945 2:100093727-100093749 GCTTCTGCAAAAAACTCAGCAGG + Intronic
938796219 2:134719579-134719601 GCTCCAGGGAGAAACTGGGAGGG - Intergenic
941054670 2:160773427-160773449 GCTTCTGGAAGCAAAGCAGAGGG + Intergenic
941289612 2:163659263-163659285 GCCTCTGGAAGAAATTTGAAAGG + Intronic
946674638 2:222145837-222145859 GCCTCTTGCAGCAACTCGGATGG + Intergenic
947504316 2:230695188-230695210 TCTTCTGGAAGAAACTGGGAGGG + Intergenic
947872324 2:233446283-233446305 GCTTCTGGGAGCAACTAGGAAGG - Intronic
1168853606 20:993378-993400 GGATCTGGAAGAATCTCCGAGGG + Intronic
1170698863 20:18685209-18685231 GCTTCTGGAAGGAAAGAGGAAGG + Intronic
1170910570 20:20562985-20563007 CCTTGTGGAAAACACTCGGAAGG + Intronic
1170933062 20:20786421-20786443 GCATCTGGAAGTAACTAGGATGG + Intergenic
1171216915 20:23358999-23359021 GCTTCTGGCAGAAGCTCAAAAGG + Intergenic
1173486910 20:43447824-43447846 GCTCCTGGAAAAAGCTGGGAAGG - Intergenic
1175241490 20:57552738-57552760 GCTTTTGGCAGAAAATTGGAAGG + Intergenic
1177343587 21:19838029-19838051 ACTTCTGGAGGAACCTTGGATGG + Intergenic
949854789 3:8451406-8451428 GTTCCTGGAAGAAACTGGTAAGG - Intergenic
953789871 3:45939113-45939135 GCTGCAGACAGAAACTCGGAAGG - Intronic
954417374 3:50399902-50399924 GCTTGTGGGGGCAACTCGGAGGG - Intronic
955295051 3:57727399-57727421 GCTTCTTTAAGAAACTTTGATGG - Intergenic
955861789 3:63338509-63338531 GCTTCTGAAAAATACTCAGAAGG - Intronic
957493265 3:80957359-80957381 GCTTTTGGTAGAATCTAGGAAGG - Intergenic
959536049 3:107485892-107485914 TTTTCTGGAAGAAACACAGAAGG + Intergenic
961975352 3:131018671-131018693 GCTTCTGTTAGAAACCCTGAAGG - Exonic
962975561 3:140442928-140442950 CCTACTGGAAGAAGCTAGGAGGG - Intronic
964028527 3:152107813-152107835 GTTTCTGGAGGCAACTTGGAGGG - Intergenic
968707412 4:2086592-2086614 TCTTCTGGAGGAAAATGGGAGGG - Intronic
969627407 4:8314226-8314248 GATTCTGGAACAACCTAGGAGGG - Intergenic
970516964 4:16841940-16841962 GCCTCTTGAAGAAACTGGGGAGG - Intronic
973792937 4:54395023-54395045 GCTTGAGGAAGAAAGACGGAGGG - Intergenic
979509692 4:121538202-121538224 GCTTTTGGCAGCAACTTGGATGG - Intergenic
986012319 5:3726880-3726902 GCTTCTTGAAGAAACTCCTTGGG - Intergenic
988234555 5:28524474-28524496 GCTCCTGGCAGAAACTGCGATGG + Intergenic
988622171 5:32834213-32834235 GATTCTGCAAAAAACTCAGACGG + Intergenic
990683062 5:58267920-58267942 GGGACTGGAAGAAACTAGGAAGG - Intergenic
996431337 5:123381550-123381572 GCTTCAGGAATAAAATCAGATGG + Intronic
998372681 5:141671608-141671630 GCTTCCGGAAGAGACCCAGACGG + Exonic
998894908 5:146788873-146788895 GTCTCTGGAAGAAACTGAGAGGG - Intronic
999136090 5:149320286-149320308 GATTCTGGCAGAAACTCTTAAGG - Intronic
999327000 5:150649858-150649880 GCTTCGGGATGCCACTCGGAAGG - Exonic
1000346699 5:160320465-160320487 ACCTTTGGAAGAAACTTGGAGGG + Intronic
1009920726 6:70056702-70056724 GCTTCTGGCAGAAAGGAGGAAGG + Intronic
1010053270 6:71532999-71533021 GCTTCTGAAAGCTACTCAGACGG - Intergenic
1012095492 6:94953233-94953255 TCTTCTAGAAGAAAATCAGAAGG - Intergenic
1013463243 6:110395531-110395553 GTTTCAGGGAGAAACTGGGAAGG + Intronic
1013761869 6:113528237-113528259 CCTTCTGAAAGCAACTTGGAAGG - Intergenic
1014111461 6:117622684-117622706 GTTGCTTGAAGAAACTCAGAGGG - Intergenic
1017388032 6:153908321-153908343 GCCTCTGAAAGAAGCTGGGAGGG + Intergenic
1018489256 6:164275080-164275102 GTTTCTGGAGGAAAATAGGATGG - Intergenic
1019647916 7:2140776-2140798 GCTTCTGGAACAATCTCCTATGG + Intronic
1019824575 7:3273160-3273182 GCTCATGGATGAAACTGGGATGG - Intergenic
1022360242 7:29650110-29650132 GCTTCTGGAAGCAGCCCAGAAGG - Intergenic
1027983971 7:85261608-85261630 TCTTTTGGAAGAAAGTGGGATGG - Intergenic
1031083575 7:117281121-117281143 CCTTCTGGCAGAAATTCTGAGGG + Intronic
1045435798 8:102162525-102162547 ACTTCTGGAAGATACTAGGAAGG - Intergenic
1047716722 8:127602577-127602599 GCTTCTTGAAGAAGCTCCTAGGG - Intergenic
1048196886 8:132338759-132338781 GCTTCTGGCAGAAAATAGGCAGG + Intronic
1050508551 9:6371207-6371229 GCTTGTGGAAGCAGCTGGGAAGG + Intergenic
1053680236 9:40481437-40481459 GCTCCTGGAAGAACCCAGGAGGG + Intergenic
1053930227 9:43109747-43109769 GCTCCTGGAAGAACCCAGGAGGG + Intergenic
1054283476 9:63143498-63143520 GCTCCTGGAAGAACCCAGGAGGG - Intergenic
1054293316 9:63316947-63316969 GCTCCTGGAAGAACCCAGGAGGG + Intergenic
1054391344 9:64621440-64621462 GCTCCTGGAAGAACCCAGGAGGG + Intergenic
1054504385 9:65894887-65894909 GCTCCTGGAAGAACCCAGGAGGG - Exonic
1056022732 9:82457461-82457483 TCATCTGGAAGGAACTCTGAGGG + Intergenic
1058314080 9:103542429-103542451 CCTTCTAGAAGAAAGTGGGATGG - Intergenic
1060785943 9:126451677-126451699 GCTTCTGGAAGGTAGTGGGAGGG - Intronic
1061998127 9:134198788-134198810 GCTTCTGGAGGAAAGTCTGATGG + Intergenic
1187367388 X:18676113-18676135 GCCTCTGGAAGAAACCAGGTGGG + Intronic