ID: 1118156427

View in Genome Browser
Species Human (GRCh38)
Location 14:63246881-63246903
Sequence CTAGATCACAACCTGTTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118156425_1118156427 3 Left 1118156425 14:63246855-63246877 CCAGGTTCCAAATTCAGCTTGAC 0: 1
1: 0
2: 0
3: 19
4: 164
Right 1118156427 14:63246881-63246903 CTAGATCACAACCTGTTTACAGG 0: 1
1: 0
2: 0
3: 6
4: 83
1118156426_1118156427 -4 Left 1118156426 14:63246862-63246884 CCAAATTCAGCTTGACAAACTAG 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1118156427 14:63246881-63246903 CTAGATCACAACCTGTTTACAGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118156427 Original CRISPR CTAGATCACAACCTGTTTAC AGG Intronic
900721323 1:4177670-4177692 CTAGGACACTTCCTGTTTACAGG + Intergenic
907861711 1:58360098-58360120 CTAGAACACAACCTTTTCAAGGG - Intronic
910354401 1:86339593-86339615 CTAGGACACTTCCTGTTTACAGG + Intergenic
911083605 1:93957735-93957757 CTAGATCACAAGCTGTATTGAGG - Intergenic
915046657 1:153023138-153023160 CTAGGACACATCCTGTTTACAGG - Intergenic
917472141 1:175334950-175334972 CTAGATAACAAGCTTCTTACCGG - Intronic
920221841 1:204410082-204410104 CTGGATCAGAACTTGTTTCCAGG + Exonic
924794947 1:247286362-247286384 CTGGAACACTTCCTGTTTACAGG + Intergenic
1071832579 10:89386466-89386488 CTGAATCACACCTTGTTTACAGG - Intronic
1074516924 10:114179185-114179207 CTAGAGCACAAGCTGCTTCCGGG + Intergenic
1074523338 10:114244268-114244290 CTAGTTCATAGCCTGTTTTCTGG + Intronic
1083145758 11:60757315-60757337 CTTGCTCACATCCTGTTTTCAGG - Intronic
1083381644 11:62274147-62274169 CTAGGACACTTCCTGTTTACAGG - Intergenic
1086145673 11:83548650-83548672 CTATATCTCAAACTGTTTACAGG - Intronic
1087049390 11:93869998-93870020 CTAGGACACTTCCTGTTTACAGG - Intergenic
1087271777 11:96119424-96119446 CTAGGGGACAACCTGTTTCCAGG - Intronic
1089314606 11:117583095-117583117 CTAGATAACCACCTGGTTACTGG - Intronic
1090445335 11:126760024-126760046 CTAGATCAAAACCAGTTGCCTGG - Intronic
1095451047 12:42330546-42330568 CTTGTTAACAACATGTTTACAGG - Intronic
1100642715 12:96498022-96498044 CTAGATCAAAACCCCTTTTCTGG + Intronic
1103745819 12:123122682-123122704 CCAGACCACAACCTGACTACAGG + Intronic
1108271179 13:48760992-48761014 CTAGGACACTTCCTGTTTACAGG + Intergenic
1114752819 14:25224636-25224658 TTAGATGACTACCTGCTTACTGG - Intergenic
1115582243 14:34772509-34772531 CTAGATGACAAACTGCTTAAAGG + Intronic
1118156427 14:63246881-63246903 CTAGATCACAACCTGTTTACAGG + Intronic
1118941621 14:70344855-70344877 CTAGGACACTTCCTGTTTACAGG + Intronic
1118942495 14:70350301-70350323 CTAGGACACTTCCTGTTTACAGG + Intronic
1128925396 15:71650708-71650730 CTAGGACACTTCCTGTTTACAGG + Intronic
1131972148 15:97903697-97903719 CAAGATCACAAACTTATTACTGG - Intergenic
1141832942 16:86519833-86519855 ATAGATCACAGCCTGTTTGGGGG - Intergenic
1148970695 17:51478716-51478738 CAAGTTCATAACTTGTTTACAGG + Intergenic
1150555648 17:66251773-66251795 CTGGTTTACAAACTGTTTACTGG + Intronic
1153955722 18:10094366-10094388 CTATATGACCATCTGTTTACAGG - Intergenic
1155574070 18:27225986-27226008 CTAGGACACTTCCTGTTTACAGG + Intergenic
1157920667 18:51710000-51710022 CTAGGACACTTCCTGTTTACAGG + Intergenic
1163423693 19:17229146-17229168 CCAGATCTCAACCTGTTCCCTGG + Exonic
1167423950 19:49420170-49420192 CTTGCTCACAACCCTTTTACCGG - Intergenic
1168716084 19:58528224-58528246 CTAGGACACTTCCTGTTTACAGG + Intronic
930844145 2:55883401-55883423 CTTGATGAAAACCTTTTTACTGG + Intronic
933168529 2:79099409-79099431 CTAGGACACTTCCTGTTTACAGG - Intergenic
934123897 2:88867268-88867290 CTTGTTAACAACATGTTTACAGG - Intergenic
936263878 2:110984932-110984954 ACAGACCACAACTTGTTTACTGG - Intronic
939496187 2:142930996-142931018 CTAGAACACTTCCTGTTTACAGG - Intronic
939497086 2:142937049-142937071 CTAGAACACTTCCTGTTTACAGG - Intronic
939871810 2:147534363-147534385 CTAGATCATAACCTCCTTTCAGG + Intergenic
944683730 2:202099567-202099589 CTTTATGACAGCCTGTTTACAGG + Intronic
945292482 2:208139648-208139670 CTAGGACACTTCCTGTTTACAGG + Intergenic
948488198 2:238294497-238294519 CTCCATCACAGCTTGTTTACAGG - Intergenic
1170418902 20:16173015-16173037 CCTGTTCACAACCTGTTTAAAGG + Intergenic
1171172049 20:23024087-23024109 CTAGGACACTTCCTGTTTACAGG - Intergenic
1182747914 22:32619835-32619857 CTAGTTCACAAAATGATTACGGG - Intronic
959690862 3:109196651-109196673 CTAGATCACACCTTGTCTAGAGG + Intergenic
961540002 3:127592781-127592803 CTAGGACACTTCCTGTTTACAGG - Intronic
961734284 3:128991605-128991627 CTAGGACACTTCCTGTTTACAGG + Intronic
967506308 3:190256602-190256624 CTAGATCAAAAGCTGTAAACAGG + Intergenic
968284317 3:197499183-197499205 CTCGATCAGAACCTGTCTGCCGG - Intergenic
970043485 4:11823017-11823039 CTTGATCTAAACCTGTTTAAAGG + Intergenic
971480589 4:27111074-27111096 CTAGGACACTTCCTGTTTACAGG - Intergenic
971812347 4:31442305-31442327 CTAGGACACTTCCTGTTTACAGG + Intergenic
973052719 4:45613941-45613963 CTAGGACACTTCCTGTTTACAGG + Intergenic
974614271 4:64261785-64261807 AGAGATCACTACTTGTTTACAGG + Intergenic
974781296 4:66556929-66556951 CTAGGACACTTCCTGTTTACAGG + Intergenic
975079846 4:70263602-70263624 CTGGACCATAAACTGTTTACTGG + Intergenic
976116396 4:81732891-81732913 CTAGATCACAAACTCTTTGAAGG - Intronic
976741251 4:88359776-88359798 CTAGGACACTTCCTGTTTACAGG + Intergenic
982735951 4:159007157-159007179 GAAGATCTCCACCTGTTTACAGG - Intronic
989664716 5:43840809-43840831 CTAGATCGCAACCTGTGCCCTGG + Intergenic
997819656 5:137053450-137053472 ATAGAGCACATCCTTTTTACAGG - Intronic
1008434106 6:51455023-51455045 CTAGATCACTAGTTCTTTACTGG + Intergenic
1010471374 6:76232035-76232057 CTATATCACAACATGTTGAATGG + Intergenic
1017080642 6:150665173-150665195 TTAGAACACAATCTGTTTGCAGG + Intronic
1026240399 7:68569278-68569300 CTCCATCACAGCCTGTTTTCTGG + Intergenic
1030988974 7:116277194-116277216 CTAGATAACAACATGATGACAGG - Intergenic
1032942260 7:136808380-136808402 CCAGATGACAACCAGTTAACAGG + Intergenic
1035111477 7:156485923-156485945 CAAGATCATGACCTGGTTACCGG - Intergenic
1037424274 8:18738157-18738179 CTACATCACAAACTGTTACCAGG + Intronic
1038853685 8:31307210-31307232 CTAGAGGACAAGCTGTTTCCAGG - Intergenic
1041425932 8:57720630-57720652 CTAGGTCACAAGCAGTTTACGGG + Intergenic
1047209522 8:122830214-122830236 CTAGGACACTTCCTGTTTACAGG - Intronic
1047210536 8:122836625-122836647 CTAGGACACTTCCTGTTTACAGG - Intronic
1048716927 8:137281514-137281536 CTAGGACACTTCCTGTTTACAGG + Intergenic
1048717849 8:137287626-137287648 CGAGAACACTTCCTGTTTACAGG + Intergenic
1050168690 9:2793128-2793150 CTAGGTCATCACCTGGTTACTGG + Intronic
1055016934 9:71628848-71628870 CAAGTTCTCAGCCTGTTTACTGG - Intergenic
1055390848 9:75821038-75821060 CTACTCCACAACCTGTTTGCTGG + Intergenic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1191150712 X:57219143-57219165 CTAGGACACTTCCTGTTTACAGG + Intergenic
1196593736 X:117519338-117519360 CTAGATTACAAGCTCTTTAAGGG + Intergenic
1196635031 X:117992472-117992494 TTAGAACACACCCTGTTTATAGG + Intronic
1197142594 X:123132739-123132761 CTAGGACACTTCCTGTTTACAGG + Intergenic