ID: 1118157399

View in Genome Browser
Species Human (GRCh38)
Location 14:63255314-63255336
Sequence GGAAATGCAGAGAGGCAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 360}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118157399_1118157407 27 Left 1118157399 14:63255314-63255336 CCCAGTTGCCTCTCTGCATTTCC 0: 1
1: 0
2: 0
3: 39
4: 360
Right 1118157407 14:63255364-63255386 CGTAACTGTCAACCACCTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1118157399_1118157408 28 Left 1118157399 14:63255314-63255336 CCCAGTTGCCTCTCTGCATTTCC 0: 1
1: 0
2: 0
3: 39
4: 360
Right 1118157408 14:63255365-63255387 GTAACTGTCAACCACCTTAGGGG 0: 1
1: 0
2: 0
3: 5
4: 46
1118157399_1118157406 26 Left 1118157399 14:63255314-63255336 CCCAGTTGCCTCTCTGCATTTCC 0: 1
1: 0
2: 0
3: 39
4: 360
Right 1118157406 14:63255363-63255385 ACGTAACTGTCAACCACCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118157399 Original CRISPR GGAAATGCAGAGAGGCAACT GGG (reversed) Intronic
900643074 1:3696554-3696576 GGAGATGCAGAGGGGCAGCCTGG + Intronic
900940835 1:5797646-5797668 GGAAATGCAGGGAGGGGACCTGG + Intergenic
901527963 1:9835936-9835958 GGAAAGGCAGGGAGGCAAACTGG + Intergenic
901863292 1:12088350-12088372 AGAAATCCAGAGAGGAAACTTGG + Intronic
902543029 1:17167679-17167701 GAAAATGCAGAGAGGAAGATGGG + Intergenic
902784062 1:18721619-18721641 GGCAAAGCAGAGAGGCTGCTGGG + Intronic
903835039 1:26198156-26198178 GGAAAAGCAGAGAGGCCTGTGGG + Intronic
904340916 1:29833968-29833990 GGCATTGCAGAGAGGCCACCTGG + Intergenic
904873740 1:33637524-33637546 GGAAATCCTGAGCAGCAACTGGG + Intronic
905274314 1:36807218-36807240 GGAGACGCAGAGAGGTCACTGGG + Intronic
905921907 1:41725237-41725259 GGACATGCAGACATGCAGCTGGG + Intronic
906011929 1:42535449-42535471 GGAAATGCAGAGTGGTATGTAGG - Intronic
906384489 1:45355757-45355779 GGAAATGCAGAGAGGAAATAAGG + Intronic
909695532 1:78464795-78464817 GGAAATACAGAGAAGCCACAAGG - Intronic
909931895 1:81506043-81506065 GGAAATGCAGAGAACAAAATGGG + Intronic
910609406 1:89125521-89125543 GTAAATGAAGGTAGGCAACTTGG - Intronic
910613865 1:89175564-89175586 GTAAATGAAGGTAGGCAACTTGG - Intronic
910717332 1:90246580-90246602 GGAAAGGCAGAGAGCTAACTGGG - Intergenic
910762168 1:90744493-90744515 GGAAATGAAGAGACCAAACTTGG - Intergenic
911204170 1:95075902-95075924 GGAAATGCAGAGAATCAAAGAGG + Intergenic
911263986 1:95721627-95721649 GAAAAAGGAGAAAGGCAACTGGG - Intergenic
913697343 1:121340098-121340120 GGAAATACAGAGAACAAACTGGG + Intronic
914140215 1:144939955-144939977 GGAAATACAGAGAACAAACTGGG - Intronic
914234134 1:145792767-145792789 GGATATGCAGACAGGCAGATAGG + Intronic
914313754 1:146489390-146489412 GGAGCTGCAGAGAGGGACCTCGG + Intergenic
914335357 1:146710160-146710182 GGGAATGAATGGAGGCAACTAGG - Intergenic
914500595 1:148243991-148244013 GGAGCTGCAGAGAGGGACCTCGG - Intergenic
915193515 1:154171836-154171858 GGAGAGGCAGTGAAGCAACTAGG + Intronic
916573747 1:166049477-166049499 GGAAATGAAGAGAGGTAATTGGG + Intergenic
918822149 1:189269281-189269303 GGAAATCTAGAAAGGCAACTAGG - Intergenic
918891641 1:190279790-190279812 GCAAATCCAGAGAGCCAACTGGG - Intronic
919821776 1:201477552-201477574 GGGAATGCACAGAGGAAAATAGG + Intergenic
919921401 1:202168570-202168592 GGAAATGGACAGAGGCCTCTGGG - Intergenic
920484676 1:206358430-206358452 GGAAATACAGAGAACAAACTGGG + Intronic
920967607 1:210714109-210714131 GAGTATGGAGAGAGGCAACTGGG + Intronic
921606783 1:217165337-217165359 GTAAATGCACAGAGGCAAGTTGG + Intergenic
923488351 1:234458726-234458748 GGAAATGTAGAGAGGGAACAAGG + Intronic
923991368 1:239440500-239440522 GAAAATGCAGGTAGGAAACTAGG + Intronic
924072260 1:240293309-240293331 GGAAATGCAAGGGGTCAACTTGG - Intronic
924567321 1:245209777-245209799 GGAAATGCAGATTGGAAACAGGG + Intronic
1062910021 10:1206226-1206248 GGGAATGGAGAGACGCACCTGGG - Intronic
1063042384 10:2356553-2356575 GGAACTGAAGAGATGAAACTGGG - Intergenic
1063484883 10:6410555-6410577 GGAAATGCACAGGGGCATCTGGG + Intergenic
1064794735 10:18998647-18998669 AGAAATGCACAGAGGAAATTTGG + Intergenic
1065456344 10:25910404-25910426 GGAAGTGCAGAAAGGAAACGTGG + Intergenic
1066218445 10:33311405-33311427 GGAAAGGCATGGAGGCCACTCGG + Intronic
1067582069 10:47452300-47452322 GGAGATGCAGAGAGGCAGTGGGG - Intergenic
1068160244 10:53253769-53253791 GGAAGTGCAGAGAGGAAATAAGG + Intergenic
1068631303 10:59300817-59300839 GGAATTACAAAGAGGCATCTGGG + Intronic
1068708274 10:60101962-60101984 AGCAGTGCAGAGAGACAACTAGG + Intronic
1069553572 10:69382019-69382041 GCAAATGCAGAGAGGTAAAAAGG - Intronic
1069566667 10:69468046-69468068 GGAAATTCAGAAAGCCAATTAGG + Intronic
1071435827 10:85647399-85647421 TGAAATGCAGAAAGGCAGCGAGG + Intronic
1071460825 10:85893863-85893885 GGAAATGCAGGGCCTCAACTAGG + Intronic
1072697121 10:97611974-97611996 GGAAGGGCAGAGGGGCAAGTAGG + Exonic
1074517014 10:114179548-114179570 GGAAGTGGAGAGAGGAGACTTGG + Intronic
1075593078 10:123706760-123706782 GGAGATGCAGGGAGGCAAAGCGG - Intronic
1075945633 10:126430707-126430729 GCAGAAGCAGACAGGCAACTTGG + Intronic
1076195660 10:128516004-128516026 GGAAATGCAGAGTCTCAACGAGG - Intergenic
1076428593 10:130384905-130384927 GGAAATACAGAGAGGCAGAGGGG - Intergenic
1078065119 11:8073624-8073646 GGATTTGCAGATAGGCAACAAGG - Intronic
1079132124 11:17753198-17753220 GGCAGTGCAGAGAGGCAGCAAGG + Intronic
1079775798 11:24524955-24524977 AGAAATGCAGGGAGGGAACTGGG + Intronic
1082661399 11:55916440-55916462 GGGAATGTAGAGAGACACCTAGG - Intergenic
1083237914 11:61363622-61363644 GAAAAAGCAGAGAGGAAACAGGG - Intronic
1085325495 11:75603263-75603285 GGAAATGTACAGAGGCCAGTGGG + Intronic
1085394846 11:76202047-76202069 AGAACTGCAGAGAGGGAACTTGG - Intronic
1085745147 11:79108857-79108879 GGGAAAGCAGACAGGGAACTGGG - Intronic
1086299530 11:85411305-85411327 GGAAATGAAGAGAGGAAACATGG + Intronic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1087915925 11:103810758-103810780 GGAAGGCCAGAGAGGCAGCTGGG - Intergenic
1089871011 11:121672715-121672737 GCTAATGCAGACAGGCAGCTGGG + Intergenic
1091456894 12:614574-614596 AGACATGTAGAGAGGCAAGTAGG - Intronic
1091616777 12:2055534-2055556 GGAGATGCTGAGAGGCAAAGGGG - Intronic
1091812398 12:3410367-3410389 GGAATTGCAGAGAGGAAGCTGGG - Intronic
1092441343 12:8508015-8508037 GGAAATACAGAGAAGCCACATGG - Intergenic
1092614385 12:10203130-10203152 GGAATCACAGAGAGGCAACAGGG - Intergenic
1092654867 12:10673887-10673909 GGAATGGCAGCGAGGCAGCTGGG - Intronic
1093147070 12:15579265-15579287 GGTAATGGAAAGAGGCAAATGGG + Intronic
1094046250 12:26170117-26170139 GGGAATGCAGGGAGTCCACTGGG - Intronic
1094313633 12:29113900-29113922 GGAGACACAGAGAAGCAACTTGG + Intergenic
1096110010 12:49023017-49023039 GGAAAGGAGTAGAGGCAACTGGG + Intronic
1097827314 12:64187373-64187395 GAAAATGGAGAGATGCAAATGGG - Intronic
1098521125 12:71436420-71436442 GGAAGTGCAGAGGGGAAATTTGG - Intronic
1103143834 12:118576685-118576707 GGAAATACAGAGGGGCACATGGG + Intergenic
1103182723 12:118928023-118928045 GGAACTGCAGGGAGGCCACTGGG + Intergenic
1103729149 12:123014406-123014428 GGAAATAATAAGAGGCAACTGGG + Intronic
1105052135 12:133064127-133064149 GGAAGTTCAAAGAGGCACCTAGG + Intergenic
1106143075 13:27027218-27027240 GGAAATGCAGAGAAGAAATGTGG + Intergenic
1107049589 13:36032829-36032851 GCAAATGCAGAGTGTAAACTTGG + Intronic
1107438708 13:40404600-40404622 GGAAGTGATGAGAGGCAGCTGGG + Intergenic
1107441273 13:40429421-40429443 GGAAATACAGTGAGGGAAGTGGG - Intergenic
1107823107 13:44304073-44304095 GGACATTCAGAGAGGCCATTTGG - Intergenic
1107888333 13:44892771-44892793 GGAAATGCAGAGAGGCCCCAGGG - Intergenic
1107944589 13:45406601-45406623 GGAAATGCAGAAAGACACCCGGG - Intronic
1108602481 13:52006738-52006760 GGAAATGGAAAGAGGCATTTAGG - Intronic
1109163418 13:59003977-59003999 AGAAATCCAGAGAGGCAGCCTGG + Intergenic
1109432617 13:62254863-62254885 GGAAAAGTAGAGATGCAACCTGG - Intergenic
1109692391 13:65910086-65910108 ACCAATGCAGAGAGCCAACTAGG - Intergenic
1110207304 13:72930390-72930412 GGAAATGCAGAGAGGTTCTTTGG + Intronic
1110541711 13:76713588-76713610 AGAGATGCAGAAAGGCATCTGGG + Intergenic
1110749748 13:79098853-79098875 GGAAATACACAGAGGGAACTAGG - Intergenic
1110813297 13:79834443-79834465 AGAAAAGCACAAAGGCAACTTGG + Intergenic
1111532238 13:89552944-89552966 CTAAATGCACAGATGCAACTTGG - Intergenic
1111568476 13:90047734-90047756 GGCAATGCAGAGGGGAAACATGG - Intergenic
1113747740 13:112756690-112756712 AGAAAGGCAAAGAGGCATCTGGG - Intronic
1113785707 13:113001182-113001204 GGAAAAGTAGAGAGGCAGCCGGG + Intronic
1114416463 14:22548110-22548132 AGAAATAAGGAGAGGCAACTTGG - Intergenic
1114833984 14:26181220-26181242 GGAAATACAGAGATGCAATGAGG - Intergenic
1114913923 14:27237590-27237612 GAAAATGCAGATAGGGAAATAGG - Intergenic
1118157399 14:63255314-63255336 GGAAATGCAGAGAGGCAACTGGG - Intronic
1118434185 14:65754394-65754416 CAATATGCAGAGAGGCAATTTGG + Intergenic
1118656974 14:67961836-67961858 GGAAATTCAGATAGGCAAAAAGG + Intronic
1118666341 14:68074882-68074904 GGAAATGCAGAGGAGCCACATGG - Intronic
1118746995 14:68781496-68781518 GGAAATGCTGAGGTGCAACGTGG - Intergenic
1120038865 14:79729586-79729608 GGAAATTCAGAGAAGCAAAAAGG - Intronic
1121263722 14:92584960-92584982 GGAAATGAAGAGGGGCTACCTGG - Intronic
1121317289 14:92969882-92969904 GGAAAGGCAGAGAGGGAAGACGG - Intronic
1121499512 14:94423013-94423035 AGAAATCCAGAAAGACAACTTGG - Intergenic
1121678939 14:95776729-95776751 GAAATTGCAGAAAGGAAACTGGG - Intergenic
1121757052 14:96411964-96411986 AGAAAAGCAGAGAGGAAAGTAGG - Intronic
1121935574 14:98015376-98015398 GGAAACAAAGAGAGGCAGCTGGG + Intergenic
1122415777 14:101548876-101548898 GGAAGGGCAGGGAGGCATCTGGG - Intergenic
1123848376 15:24327529-24327551 GGAAATCCAGAGAGACACCCTGG + Intergenic
1123867434 15:24535052-24535074 GGAAATCCAGAGAGACACCCTGG + Intergenic
1123874109 15:24606529-24606551 GGAAATCCAGAGAGACACCCTGG + Intergenic
1124063660 15:26319625-26319647 GGGGATGCAGAGAGGCAAGAGGG + Intergenic
1124384521 15:29195386-29195408 GAAACTGCAGAGAGCCACCTCGG - Intronic
1125018957 15:34966387-34966409 TGAAATGCAGAGAGGAAAGTGGG - Intronic
1127313639 15:57774452-57774474 GAAAGTGCAGAGTGGCAAGTAGG - Intronic
1127314502 15:57781897-57781919 GGACATGAAGAAAGGCACCTGGG - Intronic
1127608902 15:60617906-60617928 GGAAAAATAGAGAGGCAGCTAGG + Intronic
1128260678 15:66230866-66230888 GGAAACCCAGAGAGGGGACTTGG + Intronic
1128401819 15:67290889-67290911 GGGAATGCAGAGAGACTTCTGGG + Intronic
1128783673 15:70379359-70379381 GCAACTGTAGAGAGGCAACTTGG + Intergenic
1128905314 15:71462603-71462625 AGATATGCAGAGATACAACTTGG - Intronic
1130263119 15:82375129-82375151 GGAATAGCAGAGAGAGAACTTGG + Intergenic
1130691590 15:86086033-86086055 GGAAATGCAGTGATGCAATGAGG + Intergenic
1132303781 15:100793849-100793871 GGAAATGCAGAGGGGAAATGTGG - Intergenic
1133043064 16:3070871-3070893 GGCAATGCAGAGAGGAAATGTGG - Intronic
1133970563 16:10564764-10564786 GGAAATGCAAACAGGCAGCTCGG + Intronic
1135814866 16:25623220-25623242 GAAAATGCCAAGAGGCTACTTGG - Intergenic
1137394221 16:48105663-48105685 GGAAGATCAGAGAGGCAAATGGG + Intronic
1139083889 16:63561067-63561089 GGCAATGCAGAGGGGAAACGTGG - Intergenic
1139998266 16:71001068-71001090 GGGAATGAATGGAGGCAACTAGG + Intronic
1141638584 16:85328682-85328704 GGAATTGGAGAGAGACAACGGGG + Intergenic
1141876490 16:86828531-86828553 GGAAAACCAGAGAGGAAACAAGG + Intergenic
1142217919 16:88838916-88838938 GGAGATGGGGAGAGGCAGCTCGG - Intronic
1143721900 17:8818301-8818323 TGAAGTCCAGAGAGGCCACTGGG + Intronic
1144362735 17:14510543-14510565 GGAAATGCTGAGATGAAACCAGG - Intergenic
1146910109 17:36642841-36642863 GGAAGGGCAGCGAGGGAACTGGG - Intergenic
1147551247 17:41443571-41443593 GAAGATGCAGGGAGGCATCTAGG + Intergenic
1151108861 17:71651879-71651901 GGAATAGCTGAGAGGAAACTTGG + Intergenic
1151481838 17:74374167-74374189 GGAGAAGCAGAGAGGCAAAGTGG - Intergenic
1152242993 17:79169906-79169928 GGAAATGAAGAGAGGAAAGAAGG + Intronic
1154384346 18:13880020-13880042 GGAATTGCAGAGGGGCCTCTAGG - Intergenic
1154384362 18:13880081-13880103 GGAACTGCAGAGGGGCCTCTAGG - Intergenic
1154384372 18:13880121-13880143 GGAACTGCAGAGGGGCCCCTAGG - Intergenic
1155627109 18:27846983-27847005 GGACAAGCAGAGAGACAATTAGG - Intergenic
1155819534 18:30357174-30357196 GGAATTGCAAATAGACAACTAGG - Intergenic
1156598468 18:38575368-38575390 AGAAATGAAGAGAAGAAACTCGG + Intergenic
1157681951 18:49614246-49614268 GGAGAGGCAGAGAGGCAAAGTGG + Intergenic
1158008119 18:52696600-52696622 GGAGATGCAGATAAGCAACTAGG + Intronic
1158183896 18:54749272-54749294 GGAAAGTCAGAGAGAGAACTTGG + Intronic
1158685095 18:59606311-59606333 GGGAAAGCAGCGAGGCATCTGGG + Intronic
1158686181 18:59616628-59616650 GGAGAAGCATAAAGGCAACTGGG - Intronic
1158694624 18:59692818-59692840 GGCAGGGCAGAGAGGCACCTGGG + Intronic
1160783256 19:887815-887837 GCAGATCCAGAGAGACAACTGGG + Intronic
1161458430 19:4381639-4381661 GGAAATGAAGAGAGGCAGAGGGG - Intronic
1164390260 19:27813728-27813750 GGATATGGAGAGAAGAAACTGGG - Intergenic
1164532693 19:29060285-29060307 GGAAATCTAGGGAGGCAGCTAGG + Intergenic
1165015405 19:32876667-32876689 GGCAAGGCAGAGAGGCACCTGGG - Intergenic
1166091843 19:40514398-40514420 GGGAACCCAGAGAGGCAACTGGG + Intronic
1167088080 19:47324188-47324210 GGCAAGGCAGAGAGCCAAATGGG - Intergenic
1167403501 19:49288721-49288743 GGAAATGCAGAAGGGAAACGTGG + Intergenic
1167743646 19:51339032-51339054 GGAACTGCAGGGAGGCAGCAGGG + Exonic
925196318 2:1928964-1928986 GGATGTGCAGGGAGGGAACTGGG + Intronic
926438420 2:12861180-12861202 GGAAATACAGAGAAGGAATTAGG - Intergenic
927274563 2:21251571-21251593 GGAAATGCAGAGAGAGAATATGG + Intergenic
927943812 2:27122716-27122738 GTAGAAGCAGAGAGGCCACTGGG - Intergenic
930404873 2:50942292-50942314 GGCAATGCAGAGAGGAAATATGG + Intronic
932343888 2:70983307-70983329 GGAAAGGCATAGAGGCACCTGGG + Intronic
932453548 2:71831599-71831621 GGAAATGGGGACAGGCATCTGGG - Intergenic
932488154 2:72099093-72099115 GGGAGGGGAGAGAGGCAACTGGG + Intergenic
932493491 2:72135421-72135443 TGGAAGGCAGAGAGGCAAGTGGG + Intronic
934866269 2:97815754-97815776 GGCAATGCAGAGAGGCATTTTGG - Intronic
937484551 2:122300901-122300923 GGAAATACAGAGGAGCCACTTGG + Intergenic
938065457 2:128279829-128279851 AGAAATTCAGAGAGGCAACCTGG + Intronic
938672191 2:133597166-133597188 GGCAAAGCAGAGTGGGAACTGGG + Intergenic
941402275 2:165045298-165045320 GGAATTGCAGAAAGACCACTAGG - Intergenic
941989975 2:171546245-171546267 AGAAATTCAGAGAAGTAACTTGG - Intronic
942144918 2:173017688-173017710 GGAAAGGTAGACAGGCATCTCGG - Intronic
942450627 2:176106243-176106265 GAGAAGGCAGAGAGGCAACGGGG + Intronic
942511223 2:176704210-176704232 GGAAATGCAGAAAGGCAGAAGGG - Intergenic
942616204 2:177794332-177794354 GGAAAAGCAAAGAGGCCAGTGGG + Intronic
943622939 2:190169600-190169622 GGAAATGCAAATATCCAACTTGG - Intronic
944101783 2:196035681-196035703 GGCAATGTAGAGAGGAAAGTAGG + Intronic
945044505 2:205770277-205770299 AGAACTGCAGAAAGGCACCTAGG - Intronic
947461339 2:230306837-230306859 GGAAAGGCAGACAGGCTCCTGGG + Intronic
947983471 2:234429074-234429096 GAAGATGCAGACAGGGAACTGGG - Intergenic
948088347 2:235268861-235268883 GGAAACGCAGAGAAACAACTAGG - Intergenic
1168966727 20:1903146-1903168 GGAATTGCAAAGAGGCCAGTGGG + Intronic
1169936636 20:10890809-10890831 GGAAGGGCAGAAAGGCAAATGGG + Intergenic
1169992252 20:11516447-11516469 GGACATGCACACAGGCCACTGGG + Intergenic
1171406546 20:24915663-24915685 GCAACTCCAGAGAGGCAGCTGGG + Intergenic
1173407462 20:42778949-42778971 GGGAATGCTGAGATGCTACTGGG - Intronic
1173553665 20:43950458-43950480 GGGAGGCCAGAGAGGCAACTGGG - Intronic
1173602686 20:44307259-44307281 GGAAGTGAAGAGAGGGAACACGG + Intronic
1177252281 21:18609755-18609777 GGAAATGTAGAGATGCATCAAGG + Intergenic
1177949711 21:27519489-27519511 GGAAATACAGAAAGCAAACTTGG + Intergenic
1178446556 21:32648869-32648891 AGAAATGCAGAGAGAGAAGTAGG - Intronic
1178466046 21:32848603-32848625 GGAAAGGGAGAGAGACCACTCGG + Intergenic
1179416234 21:41200717-41200739 GGACATGCAGAGAGACACCAGGG + Intronic
1181141632 22:20809769-20809791 GGAACTGCCCAGATGCAACTTGG + Intronic
1181362993 22:22353140-22353162 GGAGATGCTGAGAGGGAAGTTGG - Intergenic
1181365803 22:22376212-22376234 GGAGATGCAGAGAGGGAAGACGG - Intergenic
1182282067 22:29223640-29223662 GGCAGAGAAGAGAGGCAACTCGG - Intronic
1182369482 22:29800928-29800950 GGAAGTGCAGAGAGGACACAGGG - Intronic
1183024555 22:35054595-35054617 TGAAATGCTGAGAGACACCTTGG - Intergenic
1183165843 22:36146882-36146904 GGAACTGCAGAGAAGGGACTGGG + Intronic
1183181133 22:36260484-36260506 GGAATTGCAGATAAGGAACTGGG - Intronic
1184250186 22:43255754-43255776 GGCAAAGCAGAGAGGCAGCGAGG + Intronic
1184418949 22:44368543-44368565 GGCAATGCAGTGAGGCAGGTGGG + Intergenic
1184938654 22:47743840-47743862 CAAAATGCACAGAGGCAATTTGG + Intergenic
1185185078 22:49394108-49394130 GGTACTGCAGAGAATCAACTTGG + Intergenic
949512558 3:4779504-4779526 GGAAATGTAGAGGGGCTGCTTGG - Intronic
952237448 3:31494587-31494609 GGGAATGCAGAGAAGCACCACGG - Intergenic
952564947 3:34644058-34644080 GGAAATAAAGAGATGCAAATTGG + Intergenic
953638539 3:44684433-44684455 GGAAGTGCAAAGAGGCATCAGGG - Intergenic
953904916 3:46863745-46863767 GGACCTGCAGAGAGGCAGCAGGG - Intronic
954191491 3:48965509-48965531 GAAAGTGCAGAGAGGAAAGTGGG - Intronic
955014991 3:55061606-55061628 GGAAATGCATAGAGAAAACCTGG - Intronic
955070096 3:55565498-55565520 GGAAATGCAGAGGTGGAACGTGG - Intronic
956176332 3:66476565-66476587 GGAACTGCAGTGTGGCATCTTGG - Intronic
958084978 3:88795386-88795408 GGCAATGCAGAGAGGAAATGTGG - Intergenic
958918127 3:100072315-100072337 GGAAATGCACAGAATGAACTAGG - Intronic
959015997 3:101134586-101134608 GGAAACTCAGAAAGGAAACTTGG - Intergenic
961336223 3:126181121-126181143 GGAATTGCAGAGAGAAAACCAGG - Exonic
961953258 3:130772489-130772511 GGATATGCAGAGAGACAAACAGG + Intergenic
962215438 3:133516908-133516930 GGACATGCAGAGAGACATCAGGG - Intergenic
962742267 3:138370438-138370460 GGCAAAGGAGAGAGGCCACTGGG + Intronic
963436486 3:145274805-145274827 GGAAAAGCAGAAATGCAACAGGG - Intergenic
964736623 3:159924841-159924863 GGATATGGAGAGAAGCAAATGGG + Intergenic
966193763 3:177294176-177294198 GGAAGAGCAGAGATGCAGCTGGG + Intergenic
968253411 3:197244235-197244257 GGAATAGCAGAGAGGGAGCTTGG + Intronic
969099739 4:4759938-4759960 GGGCATGCAGGGAGGCAAATGGG + Intergenic
969503152 4:7566772-7566794 GGAAATGCAGAGGGGGCACATGG + Intronic
969503166 4:7566862-7566884 GGAAATGCAGAGGGGGCACATGG + Intronic
970963267 4:21898205-21898227 GGAATTGCAGCTTGGCAACTGGG - Intronic
971244802 4:24917867-24917889 GGAAACGCAGAGAGGCAGCAGGG + Intronic
974087345 4:57275555-57275577 GGAAATTTAGAGAGGCTGCTCGG - Intergenic
974612188 4:64230990-64231012 GGAAATCTAGAAAGGCAAGTAGG - Intergenic
975299287 4:72770881-72770903 GGGAATGCAGGGAGACTACTTGG - Intergenic
976130308 4:81877114-81877136 GGAAATGGAGAGGGGAAAGTGGG + Intronic
976806627 4:89054520-89054542 GGAAAGGCAGAGAGAGACCTTGG - Intronic
976824809 4:89249080-89249102 AGAAATGCAGTGAGGATACTGGG + Exonic
977837576 4:101663200-101663222 GGAAATGCTGAGAGGCTTCTGGG - Intronic
980387276 4:132102580-132102602 GGAAAGGCAGAGTGGCAAGTTGG + Intergenic
981136461 4:141216093-141216115 GGAAATGGAGAGGGGCTAATCGG - Intergenic
981508516 4:145529382-145529404 GAAAAGACAGAGAGGGAACTAGG + Intronic
982537723 4:156627587-156627609 GGTAATAGAAAGAGGCAACTAGG + Intergenic
982861196 4:160451344-160451366 GGAAATGCAGTGAGAGAAATAGG + Intergenic
985051682 4:185998154-185998176 GGAAATGCAGAGGGGACTCTGGG - Intergenic
985193044 4:187398563-187398585 GGAAATGCTGACAGGCTTCTTGG - Intergenic
985239227 4:187912375-187912397 GGGAAAGCAGAGAAGCAACATGG + Intergenic
985724278 5:1507561-1507583 GGAAATGCAGAGATGAAGATGGG + Intronic
991405652 5:66298838-66298860 TGAAATTCAGAGAGGCCACTTGG - Intergenic
991422410 5:66454708-66454730 GGAAATGCAAAGTGGCACTTTGG - Intergenic
991645357 5:68795619-68795641 GAAGAGGCAGAGAGGCAACTTGG - Intergenic
992497582 5:77308881-77308903 GGAAAAGTATACAGGCAACTGGG + Intronic
992906671 5:81353518-81353540 GGATATGCAGAAAGAAAACTAGG - Intronic
995701391 5:114939340-114939362 GGCAATGCAGAGGGGAAACATGG + Intergenic
996593243 5:125172216-125172238 GGAAATGGAAAGTGGCAATTTGG + Intergenic
996945859 5:129066870-129066892 GGATTTGCAGTGAGGCACCTTGG + Intergenic
999529732 5:152449616-152449638 GGAAATTCAGAGAGAGAAGTCGG + Intergenic
999560964 5:152802412-152802434 AGAAATGCATAGAGGCACCTTGG + Intergenic
1000118601 5:158175943-158175965 GGCAATGGGGAGAGGCCACTGGG + Intergenic
1000245259 5:159443746-159443768 GAAAAAGCAGAGAAGCTACTAGG - Intergenic
1001343374 5:170867186-170867208 GGAAATAAAGAGTGGCAATTTGG + Intronic
1002140608 5:177134984-177135006 AGAAAGGCATAGAGGCCACTAGG + Intronic
1002887247 6:1308706-1308728 GGAAAGGTAAAGAGGCAGCTGGG + Intergenic
1003450621 6:6228331-6228353 AGTAAAGCAGAGAGGCAACATGG + Intronic
1003922408 6:10845720-10845742 TGAATTGTAGAGAGGCAAGTGGG + Intronic
1003969986 6:11290139-11290161 GGAAATGGACACAGGCAAATAGG - Intronic
1004750395 6:18556547-18556569 GGAAATCTAGAGAGTCACCTAGG + Intergenic
1005286187 6:24329537-24329559 TACAATGCAGACAGGCAACTTGG + Intronic
1005308985 6:24541311-24541333 GGACCTGCAGAGAGACATCTGGG - Intergenic
1006576700 6:35051708-35051730 TAGAATGCGGAGAGGCAACTGGG + Intronic
1006902245 6:37510747-37510769 GGGAATGGAGAGAGGAGACTGGG + Intergenic
1007464279 6:42041162-42041184 GGAAAGGCAGAGAAGAAACAGGG + Intronic
1007909122 6:45495594-45495616 CCAATTGCAGAGAGGAAACTGGG - Intronic
1008589791 6:52982584-52982606 GGAAATGCAGACAGGATATTAGG + Exonic
1010268272 6:73891846-73891868 GGAAATGCAGAGGGGAAATGTGG + Intergenic
1010814002 6:80333509-80333531 GGAAATCCAGAGAAACAACATGG - Intronic
1013887638 6:114989189-114989211 TGTAATGGAGAGAGGAAACTGGG + Intergenic
1013970410 6:116011495-116011517 GAAAATGCAGAAAGGAAACTGGG + Intronic
1014596314 6:123344851-123344873 GGAAATGCAAAAAGACAATTTGG - Intronic
1014822761 6:126010867-126010889 AGAAATGAAGAGAGCGAACTTGG - Intronic
1014861255 6:126470494-126470516 GGCAATGCAGAGGGGAAAGTGGG + Intergenic
1015186673 6:130424917-130424939 GGAAAAGCAGAGAGGCAGAGAGG - Intronic
1015292035 6:131548109-131548131 TGAGATGCAGAGAGAAAACTTGG + Intergenic
1015622020 6:135141334-135141356 GGGATTGCAGGGAGGAAACTCGG + Intergenic
1016206890 6:141479302-141479324 GGAAATGCAGATAGGTCTCTTGG + Intergenic
1019074981 6:169379729-169379751 GGTGATGGAGAGAGGCAGCTGGG - Intergenic
1019091004 6:169533577-169533599 GAAAAGGCAGAGAGGCAAGAGGG + Intronic
1019786103 7:2978570-2978592 AGAAATGAAGAACGGCAACTCGG + Intronic
1021467439 7:20960869-20960891 AGAAAAGCAGAGAGGGAAGTGGG - Intergenic
1022034532 7:26521129-26521151 GGAAATGCAGGGAGGAGAATGGG + Intergenic
1022199660 7:28104024-28104046 GGAACTGCAGGGAGGCCAGTGGG - Intronic
1022618843 7:31961616-31961638 GGAACTATAGACAGGCAACTGGG - Intronic
1022939741 7:35222764-35222786 GAGAGTTCAGAGAGGCAACTGGG + Intronic
1022963841 7:35454988-35455010 GGAGGTGCAGAGAGGCCGCTGGG - Intergenic
1023912556 7:44566217-44566239 GGAAATGGGGAAAGGCAGCTGGG + Intronic
1026120800 7:67535246-67535268 GAAAATGAAGAGAGCAAACTAGG - Intergenic
1026939079 7:74276506-74276528 GGGAATGGAGAGGGGAAACTAGG + Intergenic
1028170174 7:87586574-87586596 TGTAATGCAGGGAGGAAACTGGG + Intronic
1028456167 7:91040208-91040230 GGAAATGCAGAGGAGCCACCTGG - Intronic
1030989305 7:116281024-116281046 GGAAGTGCAAAGAGCAAACTGGG + Intergenic
1031131061 7:117833669-117833691 GGAATTGCAAACAGGTAACTAGG - Intronic
1032186201 7:129728727-129728749 GGAAATGCAAAGAGCCATCGTGG + Intronic
1032195508 7:129786183-129786205 AGAAATGCAGAGAGAAACCTGGG + Intergenic
1032850550 7:135791546-135791568 GGAAATGCACAGATTCATCTAGG - Intergenic
1033284302 7:140027169-140027191 GGAAAAGCAGAGCGGCAGTTAGG - Intronic
1033345944 7:140525872-140525894 TGGCATGCAGAGAGGCAGCTGGG + Intronic
1033681968 7:143603683-143603705 GGCATTGCAGGGAGGGAACTAGG - Intergenic
1033702922 7:143858230-143858252 GGCATTGCAGGGAGGGAACTAGG + Intronic
1036291561 8:7497444-7497466 GGAAATGCAGAAAGGCTTCCTGG + Intronic
1036329928 8:7814102-7814124 GGAAATGCAGAAAGGCTTCCTGG - Intronic
1037918160 8:22785359-22785381 GGAAATGCAGAGGGGCACTTGGG - Intronic
1038863066 8:31408802-31408824 GGAAATGCAGGGAGGTAAAACGG - Intergenic
1039015236 8:33140847-33140869 GGAAAAGCGGAGAAGCAAGTGGG + Intergenic
1041803792 8:61827956-61827978 GGAAAGGCAGAAAGGCAGATGGG + Intergenic
1041930342 8:63279948-63279970 GGAGAAGCACAGAAGCAACTTGG - Intergenic
1042784665 8:72535202-72535224 GGAAATGCAGAGCTGGAGCTTGG + Intergenic
1042993699 8:74669335-74669357 AGAAATGGTGAGAGGCAATTGGG - Intronic
1043043422 8:75291032-75291054 GAAAATACAAAGAGGCATCTTGG - Intergenic
1043304191 8:78773577-78773599 GGCAATACAGAGTGGCAAGTAGG + Intronic
1044387405 8:91605656-91605678 GGATTTGCAGAAAGGCAAGTGGG - Intergenic
1044537828 8:93377412-93377434 GGAATTGCAGAGACTCAAATGGG + Intergenic
1044946654 8:97395941-97395963 GGAAATACAGTGAAGCAGCTTGG - Intergenic
1045248590 8:100464608-100464630 GGTAATGCAGAAAGCCAAGTGGG + Intergenic
1046841895 8:118868300-118868322 GGAAATGCAGGGAGGCAGAGGGG - Intergenic
1047283775 8:123468364-123468386 GGATATGGAGAGAGGAAAATGGG - Intergenic
1047312694 8:123705914-123705936 GGAAAGACAGAGAGGCGACTTGG + Intronic
1047394628 8:124484341-124484363 GGGAATGAAGAAAGGCAATTTGG + Intronic
1047490190 8:125368331-125368353 GGAAAGTCAGAGATGGAACTAGG + Intergenic
1048615571 8:136071400-136071422 GGAAATGCAGAAAACTAACTGGG + Intergenic
1049469327 8:142768460-142768482 GGAAGAGCAGTGAGGCAGCTTGG + Intronic
1050385404 9:5085211-5085233 GGAACTGCTGACAGGCAAATAGG + Intronic
1050431715 9:5569012-5569034 GGAAAGGCAGAGAGGCAGGAAGG + Intronic
1051522367 9:18003476-18003498 AGAAATGCAGACAGGCATGTAGG - Intergenic
1052113194 9:24615719-24615741 TTAAATGAAGAGAGACAACTTGG - Intergenic
1052179356 9:25505474-25505496 GGCAATGCAGAGAGGAAATGTGG - Intergenic
1052820185 9:33132269-33132291 GGGAAAGCAGGGAGGCAGCTGGG + Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055249267 9:74282559-74282581 GGAAATGCAGAAAAGGCACTGGG + Intergenic
1056011876 9:82340670-82340692 GGAATTGAAGAAAGGAAACTAGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056831037 9:89917874-89917896 GGATATGTGGAGAGGCAACTGGG - Intergenic
1056976292 9:91257736-91257758 GGAAATGCAAAGAGCAAAGTTGG - Intronic
1057081748 9:92178760-92178782 AGAGCTGCAGAGGGGCAACTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1060272567 9:122157152-122157174 GAAAATGCAGAGAGTCAAAAAGG - Intronic
1060575046 9:124684149-124684171 GGTAAGGAAGAGAGGCAGCTTGG - Intronic
1061077109 9:128348413-128348435 GGAGAGGCAGTGAAGCAACTGGG - Intronic
1061255859 9:129453976-129453998 GGAAGGGCAGACAGGCAAGTTGG + Intergenic
1061705145 9:132447307-132447329 GGGGATGCAGAGAGTGAACTGGG + Intronic
1061750305 9:132772452-132772474 GGACACGCAGAGAGGCACCCAGG + Intronic
1062091596 9:134681268-134681290 GGAAATACAGGAAGGGAACTAGG + Intronic
1062291101 9:135794778-135794800 GGACAAGCAGAGAGGCACCCGGG - Intergenic
1062340735 9:136092924-136092946 TGAGATGCAGAGAGGCAGCCTGG + Intronic
1186639508 X:11440541-11440563 GAAAATCCAGAGAGGCTAATGGG - Intronic
1186967457 X:14803413-14803435 GGCAAAGCAGAGATGCTACTTGG + Intergenic
1188036876 X:25328605-25328627 GGAAATGCATAGGTGCTACTTGG + Intergenic
1188901699 X:35740569-35740591 GGAAATGCACAGAGATAACATGG - Intergenic
1189445200 X:41074882-41074904 GGAGATGCAGAGAGGCAGGTTGG + Intergenic
1189662551 X:43317561-43317583 GGTCAGGCAGAGAGGCAAGTTGG - Intergenic
1190659865 X:52644265-52644287 GTAAATGCAGAGGGGAAAATCGG + Exonic
1190676864 X:52790079-52790101 GTAAATGCAGAGGGGAAAATCGG - Intronic
1190711429 X:53073403-53073425 GGGAAGGCAGTGAGGCAATTGGG - Intronic
1190914381 X:54799469-54799491 GGAAATCCTGAGAGGAAACTTGG - Intergenic
1191255955 X:58279727-58279749 GGAAATGGAGACAGGCGACCTGG - Intergenic
1191920902 X:66255992-66256014 GGAAATGCTGAGAGGCACAGTGG + Intronic
1193787729 X:85780928-85780950 GCAAATGTAGAGAAGCAACGAGG - Intergenic
1194224970 X:91245103-91245125 GGAATTGCAGAGGGGCCACAGGG - Intergenic
1194225302 X:91249237-91249259 GGAATTGCAGAGGGGCCACAGGG + Intergenic
1194860328 X:98991171-98991193 GGAAATGCAGAGGGGAAATGTGG - Intergenic
1194944211 X:100048744-100048766 GGAAGTGCAGAGGGGAAACATGG + Intergenic
1195318747 X:103704002-103704024 GAGAGTGCAGAGAGGCAAGTGGG + Intergenic
1196076339 X:111581023-111581045 GGAAAAGCAGAAAGGTAATTGGG + Intergenic
1197152606 X:123236400-123236422 TAAAAGGCAAAGAGGCAACTAGG + Intronic
1197873865 X:131084162-131084184 GGAAATAAAGAGAGTCAATTAGG - Intronic
1197913672 X:131513097-131513119 GGAAATACAGAGGAGCCACTTGG - Intergenic
1198278889 X:135123166-135123188 AGAAATGCAGAGAGGCTTCTGGG + Intergenic
1198292070 X:135249354-135249376 AGAAGTGCAGAGAGGCTTCTGGG - Intronic
1200284362 X:154805778-154805800 GGGATTGCAGGGAGGCAACAAGG + Intronic
1200561434 Y:4708413-4708435 GGAACTGCAGAGGGGCCACAGGG - Intergenic
1201395590 Y:13544322-13544344 GGTAATTCATAGAGGCAGCTAGG + Intergenic