ID: 1118162956

View in Genome Browser
Species Human (GRCh38)
Location 14:63309439-63309461
Sequence TCAGACAGGGATATGGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118162956_1118162970 23 Left 1118162956 14:63309439-63309461 CCACCCCCCATATCCCTGTCTGA No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118162956 Original CRISPR TCAGACAGGGATATGGGGGG TGG (reversed) Intergenic