ID: 1118162957

View in Genome Browser
Species Human (GRCh38)
Location 14:63309442-63309464
Sequence GGTTCAGACAGGGATATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118162957_1118162970 20 Left 1118162957 14:63309442-63309464 CCCCCCATATCCCTGTCTGAACC No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118162957 Original CRISPR GGTTCAGACAGGGATATGGG GGG (reversed) Intergenic