ID: 1118162960

View in Genome Browser
Species Human (GRCh38)
Location 14:63309445-63309467
Sequence GGGGGTTCAGACAGGGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118162960_1118162970 17 Left 1118162960 14:63309445-63309467 CCCATATCCCTGTCTGAACCCCC No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118162960 Original CRISPR GGGGGTTCAGACAGGGATAT GGG (reversed) Intergenic