ID: 1118162964

View in Genome Browser
Species Human (GRCh38)
Location 14:63309463-63309485
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118162964_1118162977 30 Left 1118162964 14:63309463-63309485 CCCCCCGAGATCCATTGCTAAGC No data
Right 1118162977 14:63309516-63309538 AAATCCTGAAGCTCCTTCAGGGG No data
1118162964_1118162970 -1 Left 1118162964 14:63309463-63309485 CCCCCCGAGATCCATTGCTAAGC No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data
1118162964_1118162976 29 Left 1118162964 14:63309463-63309485 CCCCCCGAGATCCATTGCTAAGC No data
Right 1118162976 14:63309515-63309537 CAAATCCTGAAGCTCCTTCAGGG 0: 1
1: 0
2: 2
3: 21
4: 238
1118162964_1118162975 28 Left 1118162964 14:63309463-63309485 CCCCCCGAGATCCATTGCTAAGC No data
Right 1118162975 14:63309514-63309536 TCAAATCCTGAAGCTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118162964 Original CRISPR GCTTAGCAATGGATCTCGGG GGG (reversed) Intergenic