ID: 1118162966

View in Genome Browser
Species Human (GRCh38)
Location 14:63309465-63309487
Sequence GTGCTTAGCAATGGATCTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118162966_1118162976 27 Left 1118162966 14:63309465-63309487 CCCCGAGATCCATTGCTAAGCAC No data
Right 1118162976 14:63309515-63309537 CAAATCCTGAAGCTCCTTCAGGG No data
1118162966_1118162970 -3 Left 1118162966 14:63309465-63309487 CCCCGAGATCCATTGCTAAGCAC No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data
1118162966_1118162977 28 Left 1118162966 14:63309465-63309487 CCCCGAGATCCATTGCTAAGCAC No data
Right 1118162977 14:63309516-63309538 AAATCCTGAAGCTCCTTCAGGGG No data
1118162966_1118162975 26 Left 1118162966 14:63309465-63309487 CCCCGAGATCCATTGCTAAGCAC No data
Right 1118162975 14:63309514-63309536 TCAAATCCTGAAGCTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118162966 Original CRISPR GTGCTTAGCAATGGATCTCG GGG (reversed) Intergenic