ID: 1118162970

View in Genome Browser
Species Human (GRCh38)
Location 14:63309485-63309507
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118162959_1118162970 18 Left 1118162959 14:63309444-63309466 CCCCATATCCCTGTCTGAACCCC No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data
1118162965_1118162970 -2 Left 1118162965 14:63309464-63309486 CCCCCGAGATCCATTGCTAAGCA No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data
1118162968_1118162970 -5 Left 1118162968 14:63309467-63309489 CCGAGATCCATTGCTAAGCACAC No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data
1118162967_1118162970 -4 Left 1118162967 14:63309466-63309488 CCCGAGATCCATTGCTAAGCACA No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data
1118162960_1118162970 17 Left 1118162960 14:63309445-63309467 CCCATATCCCTGTCTGAACCCCC No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data
1118162957_1118162970 20 Left 1118162957 14:63309442-63309464 CCCCCCATATCCCTGTCTGAACC No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data
1118162956_1118162970 23 Left 1118162956 14:63309439-63309461 CCACCCCCCATATCCCTGTCTGA No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data
1118162954_1118162970 25 Left 1118162954 14:63309437-63309459 CCCCACCCCCCATATCCCTGTCT No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data
1118162961_1118162970 16 Left 1118162961 14:63309446-63309468 CCATATCCCTGTCTGAACCCCCC No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data
1118162955_1118162970 24 Left 1118162955 14:63309438-63309460 CCCACCCCCCATATCCCTGTCTG No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data
1118162962_1118162970 10 Left 1118162962 14:63309452-63309474 CCCTGTCTGAACCCCCCGAGATC No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data
1118162964_1118162970 -1 Left 1118162964 14:63309463-63309485 CCCCCCGAGATCCATTGCTAAGC No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data
1118162963_1118162970 9 Left 1118162963 14:63309453-63309475 CCTGTCTGAACCCCCCGAGATCC No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data
1118162966_1118162970 -3 Left 1118162966 14:63309465-63309487 CCCCGAGATCCATTGCTAAGCAC No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data
1118162958_1118162970 19 Left 1118162958 14:63309443-63309465 CCCCCATATCCCTGTCTGAACCC No data
Right 1118162970 14:63309485-63309507 CACACTCCACCAATTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118162970 Original CRISPR CACACTCCACCAATTCCTCC TGG Intergenic
No off target data available for this crispr