ID: 1118162972

View in Genome Browser
Species Human (GRCh38)
Location 14:63309494-63309516
Sequence TGACAGTTTCCAGGAGGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118162972_1118162976 -2 Left 1118162972 14:63309494-63309516 CCAATTCCTCCTGGAAACTGTCA No data
Right 1118162976 14:63309515-63309537 CAAATCCTGAAGCTCCTTCAGGG No data
1118162972_1118162975 -3 Left 1118162972 14:63309494-63309516 CCAATTCCTCCTGGAAACTGTCA No data
Right 1118162975 14:63309514-63309536 TCAAATCCTGAAGCTCCTTCAGG No data
1118162972_1118162977 -1 Left 1118162972 14:63309494-63309516 CCAATTCCTCCTGGAAACTGTCA No data
Right 1118162977 14:63309516-63309538 AAATCCTGAAGCTCCTTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118162972 Original CRISPR TGACAGTTTCCAGGAGGAAT TGG (reversed) Intergenic