ID: 1118162973

View in Genome Browser
Species Human (GRCh38)
Location 14:63309500-63309522
Sequence AGGATTTGACAGTTTCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118162973_1118162977 -7 Left 1118162973 14:63309500-63309522 CCTCCTGGAAACTGTCAAATCCT No data
Right 1118162977 14:63309516-63309538 AAATCCTGAAGCTCCTTCAGGGG No data
1118162973_1118162975 -9 Left 1118162973 14:63309500-63309522 CCTCCTGGAAACTGTCAAATCCT No data
Right 1118162975 14:63309514-63309536 TCAAATCCTGAAGCTCCTTCAGG No data
1118162973_1118162976 -8 Left 1118162973 14:63309500-63309522 CCTCCTGGAAACTGTCAAATCCT No data
Right 1118162976 14:63309515-63309537 CAAATCCTGAAGCTCCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118162973 Original CRISPR AGGATTTGACAGTTTCCAGG AGG (reversed) Intergenic