ID: 1118162974

View in Genome Browser
Species Human (GRCh38)
Location 14:63309503-63309525
Sequence TTCAGGATTTGACAGTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118162974_1118162977 -10 Left 1118162974 14:63309503-63309525 CCTGGAAACTGTCAAATCCTGAA No data
Right 1118162977 14:63309516-63309538 AAATCCTGAAGCTCCTTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118162974 Original CRISPR TTCAGGATTTGACAGTTTCC AGG (reversed) Intergenic