ID: 1118162975

View in Genome Browser
Species Human (GRCh38)
Location 14:63309514-63309536
Sequence TCAAATCCTGAAGCTCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118162965_1118162975 27 Left 1118162965 14:63309464-63309486 CCCCCGAGATCCATTGCTAAGCA No data
Right 1118162975 14:63309514-63309536 TCAAATCCTGAAGCTCCTTCAGG No data
1118162968_1118162975 24 Left 1118162968 14:63309467-63309489 CCGAGATCCATTGCTAAGCACAC No data
Right 1118162975 14:63309514-63309536 TCAAATCCTGAAGCTCCTTCAGG No data
1118162969_1118162975 17 Left 1118162969 14:63309474-63309496 CCATTGCTAAGCACACTCCACCA No data
Right 1118162975 14:63309514-63309536 TCAAATCCTGAAGCTCCTTCAGG No data
1118162973_1118162975 -9 Left 1118162973 14:63309500-63309522 CCTCCTGGAAACTGTCAAATCCT No data
Right 1118162975 14:63309514-63309536 TCAAATCCTGAAGCTCCTTCAGG No data
1118162966_1118162975 26 Left 1118162966 14:63309465-63309487 CCCCGAGATCCATTGCTAAGCAC No data
Right 1118162975 14:63309514-63309536 TCAAATCCTGAAGCTCCTTCAGG No data
1118162971_1118162975 0 Left 1118162971 14:63309491-63309513 CCACCAATTCCTCCTGGAAACTG No data
Right 1118162975 14:63309514-63309536 TCAAATCCTGAAGCTCCTTCAGG No data
1118162972_1118162975 -3 Left 1118162972 14:63309494-63309516 CCAATTCCTCCTGGAAACTGTCA No data
Right 1118162975 14:63309514-63309536 TCAAATCCTGAAGCTCCTTCAGG No data
1118162964_1118162975 28 Left 1118162964 14:63309463-63309485 CCCCCCGAGATCCATTGCTAAGC No data
Right 1118162975 14:63309514-63309536 TCAAATCCTGAAGCTCCTTCAGG No data
1118162967_1118162975 25 Left 1118162967 14:63309466-63309488 CCCGAGATCCATTGCTAAGCACA No data
Right 1118162975 14:63309514-63309536 TCAAATCCTGAAGCTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118162975 Original CRISPR TCAAATCCTGAAGCTCCTTC AGG Intergenic