ID: 1118163989

View in Genome Browser
Species Human (GRCh38)
Location 14:63317912-63317934
Sequence GATAGTGACAAATGCATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118163989_1118163994 6 Left 1118163989 14:63317912-63317934 CCAACCATGCATTTGTCACTATC 0: 1
1: 0
2: 0
3: 13
4: 150
Right 1118163994 14:63317941-63317963 ACCTTGCTCCTAGCATTTCAGGG 0: 1
1: 0
2: 1
3: 7
4: 149
1118163989_1118163993 5 Left 1118163989 14:63317912-63317934 CCAACCATGCATTTGTCACTATC 0: 1
1: 0
2: 0
3: 13
4: 150
Right 1118163993 14:63317940-63317962 GACCTTGCTCCTAGCATTTCAGG 0: 1
1: 0
2: 0
3: 13
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118163989 Original CRISPR GATAGTGACAAATGCATGGT TGG (reversed) Intronic
904741255 1:32677866-32677888 CATAGTGATATGTGCATGGTAGG + Intronic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
905898650 1:41566207-41566229 GTCATTCACAAATGCATGGTGGG + Intronic
907134517 1:52127170-52127192 GAAAGTGCCAGGTGCATGGTAGG - Intergenic
907869056 1:58426367-58426389 CATAGTGTCAAATTCATGGCAGG - Intronic
909762164 1:79303508-79303530 GATAGTGAAAAAGGAACGGTTGG + Intergenic
910135998 1:83970830-83970852 GATAATGACAGCTTCATGGTGGG + Intronic
910364194 1:86446515-86446537 ATTAGTGACAGATGCATGGCAGG - Intronic
910662501 1:89688810-89688832 AAGAGTGATAAATGCCTGGTAGG + Intronic
911448165 1:98026700-98026722 GGTAGTGACAAATGCTTGATAGG + Intergenic
911779567 1:101859102-101859124 GGAAGTGAAAAATGCATGATAGG + Intronic
916853149 1:168724563-168724585 GGTAGTGACAAGGGCATTGTAGG + Intronic
916873392 1:168941422-168941444 GGTATTGACAAATGCATGTAAGG - Intergenic
918304362 1:183232510-183232532 GATGGTGATAAAAGAATGGTTGG + Intronic
922044927 1:221936245-221936267 AATAGTGACGAATACATAGTAGG - Intergenic
923830165 1:237546820-237546842 AATAGTGACCAATACATGGTAGG - Intronic
923866074 1:237940864-237940886 GATTATGACGAATGCATGGGTGG + Intergenic
924062474 1:240189283-240189305 GTTACTGACAAAAGCATAGTTGG - Intronic
1067341154 10:45405316-45405338 GGTACTGACAAATGTATGGATGG - Intronic
1068261491 10:54589174-54589196 GATAGAGAGAAATGGAAGGTGGG - Intronic
1072031216 10:91524431-91524453 GATAGAGACAGATACATGATAGG - Intergenic
1072765472 10:98091400-98091422 GGGAGAGACAAATGCATGGTTGG - Intergenic
1074859521 10:117499723-117499745 GAGAGTGACAAATGCAGGTGGGG + Intergenic
1075472082 10:122698741-122698763 GAAAGTGACCAGTGCAAGGTAGG + Intronic
1075809369 10:125213575-125213597 GATAGTGACTAATAGATGGAAGG + Intergenic
1077990440 11:7405346-7405368 GATAGTGTCAAATGTCTCGTTGG + Intronic
1079552837 11:21721903-21721925 GCTATTGACACATGCATGGATGG - Intergenic
1080940941 11:36917164-36917186 AGTAGTTAGAAATGCATGGTTGG + Intergenic
1081223565 11:40493088-40493110 TATAGAGATAAATGGATGGTTGG + Intronic
1081952998 11:47061967-47061989 GATAGTGACAAAAGCATTCCAGG - Intronic
1085763578 11:79262816-79262838 GATAATGACAATTACATGGGAGG + Intronic
1087395275 11:97589213-97589235 GATCTTGCCAAATGCATGGGAGG + Intergenic
1089759782 11:120714967-120714989 CAGAGTGGCAAATGCATGGGAGG + Intronic
1090859892 11:130643409-130643431 GGTAGTGACAAATAAATAGTTGG - Intergenic
1092092587 12:5815206-5815228 GAGAGTGTAAAATGCATGGCAGG - Intronic
1093464002 12:19432170-19432192 GAGAGTAACAAATGCAGCGTGGG + Intronic
1095605327 12:44060699-44060721 GAAAGTCACAAAAGCATGGGAGG + Intronic
1097024135 12:56041754-56041776 GAGAGGGACAGATGCTTGGTGGG - Intergenic
1097249167 12:57622976-57622998 GGGAGAGACAAAGGCATGGTGGG - Intronic
1098409318 12:70163355-70163377 GAAATTGATAAATGCATGGATGG + Intergenic
1098614425 12:72505844-72505866 GATAGATACAAATGGATGATTGG - Intronic
1099821954 12:87723366-87723388 AGTAGAGACAAGTGCATGGTGGG + Intergenic
1099823285 12:87742752-87742774 GATAATGACAAATCCCTGGCTGG - Intergenic
1101829185 12:108243852-108243874 GAGGGTGACAAGGGCATGGTGGG - Intronic
1108806357 13:54161603-54161625 GATGGTGACAAATGTGGGGTAGG + Intergenic
1109328430 13:60899010-60899032 AATAATGACAAATGTATGTTTGG - Intergenic
1110634379 13:77749044-77749066 TATAGTAACAAATGCAGGCTAGG - Intronic
1112141322 13:96646601-96646623 GAAAGTGATAAGTGCATGGTAGG + Intronic
1112153243 13:96787386-96787408 GATAATGACAAATGCTGGGAAGG - Intronic
1113662950 13:112119512-112119534 CACAGTGACACATGCATGGCTGG + Intergenic
1114711507 14:24783013-24783035 AGTAGTTTCAAATGCATGGTTGG - Intergenic
1117980101 14:61334337-61334359 GAAAATGACAAATGCTGGGTAGG + Intronic
1118163989 14:63317912-63317934 GATAGTGACAAATGCATGGTTGG - Intronic
1119060290 14:71467188-71467210 GATATTTACAAATGCACCGTTGG + Intronic
1120142382 14:80942974-80942996 GATAGTTGCAAATGCATAGGAGG - Intronic
1125354700 15:38804664-38804686 AATGGTGACTAATGCATAGTAGG - Intergenic
1127377106 15:58394919-58394941 GCTACTGACACATTCATGGTGGG - Intronic
1127651649 15:61014447-61014469 AATAGGGACAAATGTAAGGTAGG - Intronic
1127725272 15:61743635-61743657 GAGAGTGCTAAATGAATGGTGGG + Intergenic
1131403492 15:92145119-92145141 GGGAGAGAAAAATGCATGGTGGG + Intronic
1132072202 15:98788161-98788183 TGTAGGAACAAATGCATGGTAGG + Intronic
1140292312 16:73671444-73671466 CAGAGAGACAAATACATGGTTGG + Intergenic
1141398291 16:83724172-83724194 GTGAGTGATAAATGCATGGGTGG + Intronic
1141543747 16:84748233-84748255 TATAATGAGAAATGCATGGTGGG + Intronic
1144163131 17:12581403-12581425 CATTGTAGCAAATGCATGGTGGG - Intergenic
1144204741 17:12972163-12972185 GATAGAGACAAATGCTGGTTGGG + Intronic
1146144160 17:30396767-30396789 GATACTGGTAAATGAATGGTAGG + Intronic
1150060860 17:62066771-62066793 TATAGTTACAAATGAATGGGTGG + Intergenic
1155590926 18:27426328-27426350 TAAAGTGCCAAAGGCATGGTAGG - Intergenic
1158331812 18:56370546-56370568 TTTAATGAGAAATGCATGGTTGG + Intergenic
1158522797 18:58185575-58185597 AAAAATGACAAATGCCTGGTTGG + Intronic
1160535592 18:79589811-79589833 GAGAGTGAGACATGCAGGGTGGG - Intergenic
1166528826 19:43530222-43530244 GATAGTGACAAAATAATGATGGG - Intronic
926757456 2:16247732-16247754 GATAGCCACCAATGCATGGGTGG + Intergenic
928131506 2:28655071-28655093 GATACTGTCAAATGCATCCTGGG - Intergenic
933250840 2:80026888-80026910 AATAGTGTCAAATACATAGTAGG - Intronic
939658604 2:144859063-144859085 CAAGGTGCCAAATGCATGGTCGG - Intergenic
940346463 2:152633981-152634003 GATAGTGCCAAGTACATGGAGGG - Intronic
942832324 2:180251798-180251820 GATAGGGACACCAGCATGGTTGG + Intergenic
943952528 2:194148555-194148577 GAGAGTGAGAAATGCAGAGTAGG + Intergenic
944852336 2:203732782-203732804 GAAAATGACAGATGCATGGCTGG - Intronic
945785608 2:214232629-214232651 AAAAGTGCCAAATGCATGTTTGG + Intronic
948229301 2:236337924-236337946 GACAGTGACAAAAGCCTTGTGGG - Intronic
949066011 2:241990630-241990652 CAGAGTGACAGATGCATGGATGG - Intergenic
1168732119 20:93715-93737 GATACTGACAATTGCAAGTTGGG - Intronic
1171023182 20:21605169-21605191 GATTGTGAGAAATCAATGGTGGG - Intergenic
1173281939 20:41636325-41636347 GTTACTGATAAATGAATGGTGGG + Intergenic
1173439222 20:43060677-43060699 TTTAGTGCTAAATGCATGGTGGG - Intronic
1173858316 20:46265575-46265597 GATGGTCAGAAATGCATAGTTGG - Intronic
1175789004 20:61730212-61730234 GGTTTGGACAAATGCATGGTGGG + Intronic
1176884289 21:14235422-14235444 GATTCTGACAAAAGCATGATTGG + Intergenic
1182743890 22:32589830-32589852 GATAGTGACAAATTAATGTATGG - Intronic
1184055383 22:42044195-42044217 CATAGTGGCACATGCCTGGTGGG - Intronic
1184251863 22:43265118-43265140 CCCAGTGACAAATGTATGGTTGG - Intronic
955892594 3:63665922-63665944 AATCCTGTCAAATGCATGGTAGG + Intronic
956678709 3:71758287-71758309 TATAGTGACAACTGCGTGGGAGG - Intergenic
957824101 3:85418217-85418239 GATTTTGACAAATGTATGATAGG - Intronic
958812548 3:98878541-98878563 GATAGAAACAAATACATTGTGGG - Intronic
960658424 3:120031662-120031684 GATGGTGATAACTGCATTGTGGG - Intronic
961847971 3:129784602-129784624 GATAATGATAAATACATGGTGGG + Intronic
963222092 3:142824252-142824274 GATATTGCCAAATGCCTGCTGGG - Intronic
964515615 3:157504585-157504607 CATAGTGACTAATGCAGGGCAGG + Intronic
964643009 3:158929862-158929884 CATGGTGGCAAATTCATGGTGGG + Intergenic
965489334 3:169317676-169317698 GACAGTGACTAATGCTTAGTGGG + Intronic
965977894 3:174647815-174647837 TACAGTGCCAAGTGCATGGTTGG - Intronic
967044234 3:185721940-185721962 GTTAGTGATAAGTGAATGGTTGG - Intronic
967945457 3:194800401-194800423 GAGAGTGACACATGCCTTGTGGG - Intergenic
969599400 4:8167012-8167034 GATAGAAACAGATGGATGGTGGG - Intergenic
969979271 4:11137804-11137826 CATAGTGACAAATACAAAGTAGG + Intergenic
970789039 4:19834747-19834769 AATAGTGAGAAATGCATGATGGG + Intergenic
972627174 4:40811105-40811127 TTTAGTGCCAAATGCATGTTAGG - Intronic
972760259 4:42096384-42096406 GAGAGTGACAAAAGCCTGATTGG - Intergenic
974554128 4:63421292-63421314 GATATTGAAAAATGCATTGTGGG - Intergenic
975103994 4:70547986-70548008 GGTAGTAACACATGAATGGTAGG - Intergenic
976027272 4:80704338-80704360 GAGAATGAGAAATGCAGGGTTGG + Intronic
980950657 4:139372843-139372865 CATTCTGACAAATGCATGCTTGG + Intronic
987902094 5:24025535-24025557 GATAGTTACAAAATAATGGTGGG + Intronic
988932646 5:36051754-36051776 GAAAGTGACGAATGGATGGATGG - Intronic
989480014 5:41919916-41919938 CATAGTGCTTAATGCATGGTAGG + Exonic
990998123 5:61753902-61753924 TAAAGAGACAAATGCATGGATGG - Intergenic
992886685 5:81166701-81166723 GATGGTATCAGATGCATGGTGGG + Intronic
994064983 5:95529257-95529279 GATGGAGAAAAATGTATGGTGGG - Intronic
997826914 5:137114607-137114629 GATACTGATAAAGGGATGGTGGG + Intronic
998956313 5:147442031-147442053 GATATTGATAAATTCATAGTGGG - Intronic
999739114 5:154535914-154535936 GATACTGAGAAATGCTTGTTGGG - Intergenic
1000287903 5:159843792-159843814 GAGAGTGATAAGTCCATGGTGGG - Intergenic
1001728791 5:173931753-173931775 GGTAGCCACAAATGCATGGCGGG - Intronic
1004787084 6:18981152-18981174 GAAAGTGACTGATACATGGTTGG - Intergenic
1008678149 6:53843704-53843726 GATAGTGTCAAATGCAAGCTTGG - Intronic
1012545468 6:100414051-100414073 GATAGTGACAAATACATTTGGGG + Intronic
1013182370 6:107729001-107729023 AAAAGTGACAGATGCATGGATGG + Intronic
1018851916 6:167646575-167646597 GACGGAGACAGATGCATGGTTGG - Intergenic
1021013452 7:15501613-15501635 TACAGTGACAAATGCAGGGATGG + Intronic
1021918978 7:25464711-25464733 TATAGTGAGAAATGCATATTTGG - Intergenic
1027924225 7:84439965-84439987 TATAGTGCCTAATACATGGTAGG - Intronic
1028224895 7:88238819-88238841 GACAGTGACAAGTGCAAGGATGG + Intergenic
1028989245 7:97032520-97032542 GAAAGTGACAATTGCAAGGATGG - Intergenic
1029923634 7:104292747-104292769 GATACTGAAAAATGCCTGGGTGG + Intergenic
1030279194 7:107752760-107752782 GATATTGATAAATGCATTGTAGG + Intronic
1033301087 7:140186343-140186365 AATAATGACAAATGAATGGATGG - Intergenic
1033896372 7:146075141-146075163 GATATTGACAAATGCTTTTTTGG - Intergenic
1034150750 7:148913718-148913740 GATAGTGACATAAGCATGTGCGG + Intergenic
1037362251 8:18085533-18085555 GTTAGTGACAAATGCAGTGGAGG + Intergenic
1037369852 8:18164067-18164089 CATAGTGAAAAATGCATGAAAGG + Intergenic
1037606538 8:20442450-20442472 GATAGGGACAAAGGCCTGTTTGG + Intergenic
1038262239 8:26006061-26006083 GACAGAGACAAATGCAGAGTGGG + Intronic
1038707391 8:29907483-29907505 GACAGTGACAAATACCTGGTAGG - Intergenic
1038766262 8:30430864-30430886 GATAGTGCCTACTACATGGTAGG - Intronic
1038833420 8:31089843-31089865 GATAGAGACATATGAATGGATGG - Intronic
1039321411 8:36435769-36435791 GATAGCGATAAATGGATGGATGG - Intergenic
1040910696 8:52515621-52515643 GATACTTTAAAATGCATGGTTGG - Intergenic
1042357479 8:67844845-67844867 GATGGTAACAAATCCATGGCTGG + Intergenic
1046597994 8:116284083-116284105 GAGACTGACAGATGCATGTTTGG - Intergenic
1048355800 8:133653302-133653324 GATAGTCACAACTGCAGGGTAGG - Intergenic
1052438412 9:28461328-28461350 GATAGTGAGGGATGAATGGTAGG - Intronic
1052613399 9:30805812-30805834 GATATTGACAACAGCATGTTGGG - Intergenic
1056419059 9:86406006-86406028 CATAATTACAAATGCAGGGTAGG - Intergenic
1059563655 9:115360381-115360403 GGTAGGGACAAAGGCAAGGTTGG - Intronic
1061417130 9:130453189-130453211 CATAGGGACTAATGCGTGGTGGG - Intronic
1186503223 X:10068725-10068747 GATAGTGGCACATACCTGGTTGG + Intronic
1193745865 X:85280466-85280488 GATGGTTACATATGCATGTTCGG - Intronic
1193928523 X:87522036-87522058 GATAGGGTCAAATGTATTGTAGG + Intronic
1194643956 X:96435283-96435305 GATAGTGACATTTGCATGTTAGG - Intergenic
1201342606 Y:12950960-12950982 GACAGTGAGAAATGGCTGGTGGG + Intergenic