ID: 1118168064

View in Genome Browser
Species Human (GRCh38)
Location 14:63357500-63357522
Sequence TCTGACCATCCTGGCTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170639
Summary {0: 11, 1: 111, 2: 10363, 3: 64363, 4: 95791}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118168064_1118168072 29 Left 1118168064 14:63357500-63357522 CCATGTTAGCCAGGATGGTCAGA 0: 11
1: 111
2: 10363
3: 64363
4: 95791
Right 1118168072 14:63357552-63357574 AGTTGGACAAACACTATCAGGGG No data
1118168064_1118168070 27 Left 1118168064 14:63357500-63357522 CCATGTTAGCCAGGATGGTCAGA 0: 11
1: 111
2: 10363
3: 64363
4: 95791
Right 1118168070 14:63357550-63357572 GAAGTTGGACAAACACTATCAGG No data
1118168064_1118168067 4 Left 1118168064 14:63357500-63357522 CCATGTTAGCCAGGATGGTCAGA 0: 11
1: 111
2: 10363
3: 64363
4: 95791
Right 1118168067 14:63357527-63357549 GAGTTTTAATTAAAGTTGGTTGG No data
1118168064_1118168066 0 Left 1118168064 14:63357500-63357522 CCATGTTAGCCAGGATGGTCAGA 0: 11
1: 111
2: 10363
3: 64363
4: 95791
Right 1118168066 14:63357523-63357545 TTGTGAGTTTTAATTAAAGTTGG No data
1118168064_1118168071 28 Left 1118168064 14:63357500-63357522 CCATGTTAGCCAGGATGGTCAGA 0: 11
1: 111
2: 10363
3: 64363
4: 95791
Right 1118168071 14:63357551-63357573 AAGTTGGACAAACACTATCAGGG No data
1118168064_1118168069 12 Left 1118168064 14:63357500-63357522 CCATGTTAGCCAGGATGGTCAGA 0: 11
1: 111
2: 10363
3: 64363
4: 95791
Right 1118168069 14:63357535-63357557 ATTAAAGTTGGTTGGGAAGTTGG No data
1118168064_1118168068 5 Left 1118168064 14:63357500-63357522 CCATGTTAGCCAGGATGGTCAGA 0: 11
1: 111
2: 10363
3: 64363
4: 95791
Right 1118168068 14:63357528-63357550 AGTTTTAATTAAAGTTGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118168064 Original CRISPR TCTGACCATCCTGGCTAACA TGG (reversed) Intergenic
Too many off-targets to display for this crispr