ID: 1118168065

View in Genome Browser
Species Human (GRCh38)
Location 14:63357509-63357531
Sequence AACTCACAATCTGACCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118168065_1118168066 -9 Left 1118168065 14:63357509-63357531 CCAGGATGGTCAGATTGTGAGTT No data
Right 1118168066 14:63357523-63357545 TTGTGAGTTTTAATTAAAGTTGG No data
1118168065_1118168069 3 Left 1118168065 14:63357509-63357531 CCAGGATGGTCAGATTGTGAGTT No data
Right 1118168069 14:63357535-63357557 ATTAAAGTTGGTTGGGAAGTTGG No data
1118168065_1118168068 -4 Left 1118168065 14:63357509-63357531 CCAGGATGGTCAGATTGTGAGTT No data
Right 1118168068 14:63357528-63357550 AGTTTTAATTAAAGTTGGTTGGG No data
1118168065_1118168067 -5 Left 1118168065 14:63357509-63357531 CCAGGATGGTCAGATTGTGAGTT No data
Right 1118168067 14:63357527-63357549 GAGTTTTAATTAAAGTTGGTTGG No data
1118168065_1118168071 19 Left 1118168065 14:63357509-63357531 CCAGGATGGTCAGATTGTGAGTT No data
Right 1118168071 14:63357551-63357573 AAGTTGGACAAACACTATCAGGG No data
1118168065_1118168070 18 Left 1118168065 14:63357509-63357531 CCAGGATGGTCAGATTGTGAGTT No data
Right 1118168070 14:63357550-63357572 GAAGTTGGACAAACACTATCAGG No data
1118168065_1118168072 20 Left 1118168065 14:63357509-63357531 CCAGGATGGTCAGATTGTGAGTT No data
Right 1118168072 14:63357552-63357574 AGTTGGACAAACACTATCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118168065 Original CRISPR AACTCACAATCTGACCATCC TGG (reversed) Intergenic
No off target data available for this crispr