ID: 1118168067

View in Genome Browser
Species Human (GRCh38)
Location 14:63357527-63357549
Sequence GAGTTTTAATTAAAGTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118168064_1118168067 4 Left 1118168064 14:63357500-63357522 CCATGTTAGCCAGGATGGTCAGA 0: 11
1: 111
2: 10363
3: 64363
4: 95791
Right 1118168067 14:63357527-63357549 GAGTTTTAATTAAAGTTGGTTGG No data
1118168065_1118168067 -5 Left 1118168065 14:63357509-63357531 CCAGGATGGTCAGATTGTGAGTT No data
Right 1118168067 14:63357527-63357549 GAGTTTTAATTAAAGTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118168067 Original CRISPR GAGTTTTAATTAAAGTTGGT TGG Intergenic
No off target data available for this crispr