ID: 1118173952

View in Genome Browser
Species Human (GRCh38)
Location 14:63419145-63419167
Sequence GCATACACAAAATTACCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118173952_1118173953 -2 Left 1118173952 14:63419145-63419167 CCAATGGGTAATTTTGTGTATGC 0: 1
1: 0
2: 0
3: 13
4: 162
Right 1118173953 14:63419166-63419188 GCCACAAATTTAAATCAAAAAGG 0: 1
1: 0
2: 2
3: 51
4: 381
1118173952_1118173955 6 Left 1118173952 14:63419145-63419167 CCAATGGGTAATTTTGTGTATGC 0: 1
1: 0
2: 0
3: 13
4: 162
Right 1118173955 14:63419174-63419196 TTTAAATCAAAAAGGTATGCAGG 0: 1
1: 1
2: 14
3: 407
4: 1147
1118173952_1118173957 24 Left 1118173952 14:63419145-63419167 CCAATGGGTAATTTTGTGTATGC 0: 1
1: 0
2: 0
3: 13
4: 162
Right 1118173957 14:63419192-63419214 GCAGGAGCAGTCAATTAGCTGGG 0: 1
1: 0
2: 1
3: 6
4: 118
1118173952_1118173956 23 Left 1118173952 14:63419145-63419167 CCAATGGGTAATTTTGTGTATGC 0: 1
1: 0
2: 0
3: 13
4: 162
Right 1118173956 14:63419191-63419213 TGCAGGAGCAGTCAATTAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118173952 Original CRISPR GCATACACAAAATTACCCAT TGG (reversed) Intronic
909689625 1:78392741-78392763 TCACACACAAAAACACCCATAGG - Intronic
913413108 1:118574327-118574349 GCATACACAAAATTAACTGAAGG + Intergenic
913574338 1:120155431-120155453 TCATGCACAAAATTCCCAATTGG + Exonic
914295606 1:146320234-146320256 TCATGCACAAAATTCCCAATTGG + Intergenic
914359799 1:146923942-146923964 GCATACAAAAAATTATCCCTTGG - Intergenic
914493952 1:148175952-148175974 GCATACAAAAAATTATCCCTTGG + Intergenic
914556646 1:148771015-148771037 TCATGCACAAAATTCCCAATTGG + Intergenic
914616188 1:149359215-149359237 TCATGCACAAAATTCCCAATTGG - Intergenic
916668231 1:166987282-166987304 GCATACATAAAAGTATACATAGG - Intronic
916727078 1:167533047-167533069 GCAAACACAAAATTATCCTGTGG + Intronic
919774770 1:201187348-201187370 GCAAACATGAAATTACCCTTGGG + Intergenic
921063137 1:211603119-211603141 GCAAACACAAAATTAGGCACAGG + Intergenic
921960334 1:221027424-221027446 GAGAACACAAAATTTCCCATGGG + Intergenic
923246148 1:232134568-232134590 GCATACACCAAATAACCAGTGGG + Intergenic
1066964075 10:42245165-42245187 TCATATACAACAATACCCATTGG - Intergenic
1070807711 10:79280144-79280166 AAATACAAAAAATTAGCCATGGG - Intronic
1070906882 10:80080784-80080806 ACACACACAAAATTAGCCATGGG + Intronic
1074010882 10:109478278-109478300 GCAAACACAAAATTATACAGGGG - Intergenic
1074972769 10:118553156-118553178 ACATACAAAGCATTACCCATAGG - Intergenic
1077425119 11:2472411-2472433 GCATACACACACACACCCATAGG - Intronic
1079544770 11:21619966-21619988 TCATATACAAAATTATGCATGGG + Intergenic
1080993099 11:37565268-37565290 CCCTACAAAAAATTACCAATGGG + Intergenic
1082778001 11:57262793-57262815 GCATACACCAAGTAACCAATGGG + Intergenic
1088078412 11:105879395-105879417 ACATAAATAAAATTACCTATTGG + Intronic
1089142403 11:116296478-116296500 GCGTACACCAAGTAACCCATGGG + Intergenic
1089370293 11:117950758-117950780 ACATACACACAAATACCCACTGG + Intergenic
1089419817 11:118323043-118323065 GGATCCACAACATCACCCATGGG - Intergenic
1090450170 11:126799181-126799203 GCACACACACAGATACCCATAGG - Intronic
1090741763 11:129668457-129668479 GCATATCCAAACTTGCCCATAGG - Intergenic
1094613526 12:32016204-32016226 GCACACACACACTTACACATAGG + Intergenic
1095572276 12:43696920-43696942 GCATGCAGAAAATAATCCATGGG + Intergenic
1096413415 12:51392681-51392703 GCATGCACAAAATCACCCGGAGG - Intronic
1096864485 12:54554079-54554101 ACATACACAAGATCACACATAGG - Intronic
1101578699 12:106022074-106022096 GCAAACAAAAAAAGACCCATAGG + Intergenic
1102360865 12:112286531-112286553 ACACACACAAAATTATCCAAGGG + Intronic
1103554991 12:121760861-121760883 TAATACAAAAAATTACCTATGGG - Intronic
1106035961 13:26045923-26045945 AAATACAAAAAATTAGCCATGGG + Exonic
1107017885 13:35722277-35722299 GCACAAACAAAAGAACCCATAGG - Intergenic
1108012525 13:46033936-46033958 GTATACAGAATATTACCAATTGG + Intronic
1108066230 13:46580387-46580409 GCATACTGCAAATTACCCTTTGG - Intronic
1111936178 13:94559060-94559082 GCGTACACAAAGTAACCAATGGG + Intergenic
1112977701 13:105341375-105341397 GCTGACATAAAAGTACCCATAGG + Intergenic
1116016197 14:39410214-39410236 GCACTCAAAAAATTAACCATAGG - Intronic
1116299556 14:43160526-43160548 GCATACACAAAATGATAAATTGG - Intergenic
1117333059 14:54733464-54733486 GCATACTGAAAATTACTCAGGGG - Intronic
1118173952 14:63419145-63419167 GCATACACAAAATTACCCATTGG - Intronic
1118945589 14:70383764-70383786 ACACACACAAAATGAACCATGGG + Intronic
1122758398 14:104001126-104001148 GGTTACACAAACTTACACATGGG - Intronic
1124927050 15:34080573-34080595 AAATACACAAAATTAGCCAGGGG + Intergenic
1124995644 15:34720767-34720789 CCAAACACAAAATGACCCAAAGG + Intergenic
1129833737 15:78688302-78688324 AAATACAAAAAATTAGCCATGGG + Intronic
1131392640 15:92061806-92061828 GCATCCACAAACAAACCCATAGG - Intronic
1133099047 16:3468000-3468022 GCATGCACCAAATAACCAATGGG - Intronic
1133666806 16:7976308-7976330 GCACACACAAAAAAACCCATAGG + Intergenic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1141144263 16:81518020-81518042 ACACACACACAATTAACCATGGG - Intronic
1144992939 17:19246428-19246450 CCAGAGAGAAAATTACCCATTGG - Intronic
1145103934 17:20099149-20099171 TAATAAACAAAATTACACATAGG - Intronic
1149213051 17:54325599-54325621 GCACACAGATAATTACCCTTGGG + Intergenic
1154393211 18:13961779-13961801 TCATACACAAAAATACACACAGG - Intergenic
1155743362 18:29318683-29318705 ACACACACAAAATTGGCCATGGG + Intergenic
1158997279 18:62935224-62935246 GTATACACAAACATAGCCATTGG + Intronic
1159203261 18:65216509-65216531 GCACACACAAAATCATCCACAGG + Intergenic
1163798682 19:19352134-19352156 GCAAATATAAAATTACCCAGTGG - Intronic
1164423343 19:28117165-28117187 TCATGCACAAAATAACCCCTAGG - Intergenic
1164484094 19:28640163-28640185 GCTTAGACAAGATCACCCATGGG - Intergenic
1168074648 19:53973362-53973384 ACATACAAAAAATTAGCCAGGGG + Intronic
928794609 2:35001660-35001682 TCATACACATAATTTCCTATGGG - Intergenic
929680290 2:43987334-43987356 GAATACAAAAAATTAGCCAGGGG + Intronic
933068789 2:77832947-77832969 GAAGAAACAAAAGTACCCATAGG + Intergenic
935190070 2:100770188-100770210 GCATACAAAAAATGACCTCTTGG - Intergenic
935544874 2:104390286-104390308 GCATACATAAATTTACCTATGGG + Intergenic
935544881 2:104390397-104390419 GCATACGTAAATTTACCTATGGG + Intergenic
937024256 2:118684179-118684201 ACATACAAAAAATTAGCCAGGGG + Intergenic
938643364 2:133306087-133306109 GGATCCACAAAATTCCCCCTAGG - Intronic
938778821 2:134565825-134565847 GCAAACACAAAAGCACTCATTGG + Intronic
939423407 2:142003324-142003346 ATTTGCACAAAATTACCCATTGG - Intronic
944485786 2:200203815-200203837 GCATACACCAAGTAACCAATGGG + Intergenic
945330306 2:208531431-208531453 ACAGAAACAAAATAACCCATGGG - Intronic
946509487 2:220339188-220339210 GCATACAAAAAAATAACCTTTGG - Intergenic
947154446 2:227147200-227147222 GCATCCACAAAATCACCAAATGG - Intronic
947675083 2:231971604-231971626 AAATACACAAAATTAGCCAGGGG - Intronic
1173680642 20:44878378-44878400 ACATCCACAAAATTACTCATTGG - Intergenic
1174856213 20:54047864-54047886 GCATACACCAAGTAACCAATGGG - Intronic
1177750393 21:25275731-25275753 TCATACATAAAACTACCCTTTGG + Intergenic
949107386 3:217178-217200 ACAGAAAAAAAATTACCCATGGG + Intronic
949439704 3:4067214-4067236 TGATACACCAAATAACCCATTGG - Intronic
951934568 3:28007452-28007474 TCATATACAAAATTTCTCATAGG - Intergenic
952576839 3:34784431-34784453 ACATACAAAAAAGTACACATAGG + Intergenic
955165236 3:56504429-56504451 GAATACAAAAAATTAGCCAGGGG + Intergenic
957632127 3:82729980-82730002 GGGTACACTAAAATACCCATAGG + Intergenic
959523026 3:107342207-107342229 GCATACACCAAGTAACCAATGGG + Intergenic
960573568 3:119207927-119207949 GCATAGACAAAATTATGCAGTGG - Intergenic
960645735 3:119880467-119880489 GCATACAAGAAACTACACATAGG - Intronic
962972342 3:140414590-140414612 GGATAAAAAAAACTACCCATTGG + Intronic
964526349 3:157619040-157619062 ACATACACACCATTAGCCATGGG - Intronic
969940072 4:10723073-10723095 GCATACACCAAGTAACCAATAGG - Intergenic
970090275 4:12399329-12399351 ACATACACAATATTACTCAATGG + Intergenic
970109174 4:12618198-12618220 GTCTACACAAAATTACCCTGAGG - Intergenic
970981428 4:22103103-22103125 GTATACACAAAATTTGCCAAGGG - Intergenic
971319023 4:25590464-25590486 GCATACACCAAGTAACCAATGGG + Intergenic
972174377 4:36385620-36385642 CAAAACACAAAATTACCCCTAGG + Intergenic
974049443 4:56926664-56926686 CCATACTCAAAGTTACCAATTGG + Intronic
975036370 4:69687837-69687859 ACAAACACAGAATTAACCATTGG + Intergenic
977754129 4:100646241-100646263 GGATAAAAAAAACTACCCATTGG - Intronic
978046724 4:104138329-104138351 GCAAACTGCAAATTACCCATTGG - Intergenic
980289811 4:130831344-130831366 GCATACAATAAAATACACATTGG + Intergenic
982046676 4:151454358-151454380 GCAGACCCAAAGTTACCTATAGG - Intronic
984190674 4:176601725-176601747 ACACACACACACTTACCCATAGG + Intergenic
985166710 4:187103341-187103363 GCATACACAAAATTGCTTATAGG - Intergenic
985239830 4:187918207-187918229 GTATACACAAAAATACACCTTGG - Intergenic
985389330 4:189478686-189478708 TCTTACTCAAAATTACCCAGTGG - Intergenic
985690791 5:1311113-1311135 GCATACACCAAGTAACCAATGGG - Intergenic
986254305 5:6088977-6088999 GTATACACCAAATAACCAATGGG + Intergenic
989764608 5:45066733-45066755 GGATAGACAAAATTACACAAAGG + Intergenic
991074693 5:62521841-62521863 GAAAACACAAAAGAACCCATAGG - Intronic
994595383 5:101826294-101826316 GTGCACACAAAATTACCTATAGG - Intergenic
995262008 5:110115046-110115068 GCAAACACAAAATGCCCAATAGG - Intergenic
995738241 5:115326659-115326681 ACATACAGAAAATTAACCACTGG - Intergenic
996086143 5:119307071-119307093 ACATACAGAAAATTACTCTTTGG + Intronic
996437926 5:123456184-123456206 TCAAATACAAAATAACCCATTGG - Intergenic
997405178 5:133640037-133640059 GCAAACACAAAAGTAACAATAGG + Intergenic
997563500 5:134869194-134869216 ACACACACAAAATTAACAATGGG - Intergenic
1000264745 5:159624467-159624489 GCATACACCAAATAATCAATGGG + Intergenic
1000315146 5:160083305-160083327 GCATCCCCAAAATGACCCATGGG + Intronic
1000317033 5:160102247-160102269 AAATACAAAAAATTACCCAGGGG + Intronic
1003669810 6:8146503-8146525 GCATACACACAAGTACCTAATGG - Intergenic
1004416858 6:15432580-15432602 GCATACACCAAGTAACCAATGGG - Intronic
1004972348 6:20924434-20924456 GCATTCACAACATGACCCAACGG - Intronic
1006937156 6:37726468-37726490 ACAGAGACAAAATTACTCATAGG + Intergenic
1008434847 6:51463925-51463947 GCATACACAATAATAAGCATAGG + Intergenic
1009239553 6:61167363-61167385 CCATACACAAAATTAACTACGGG - Intergenic
1009275258 6:61669857-61669879 GCATACACAAATCAACCTATTGG + Intergenic
1009752463 6:67889530-67889552 TCAGCCACAAAACTACCCATGGG + Intergenic
1010600539 6:77820422-77820444 AAATACACAAAATTAGCCAGGGG - Intronic
1012094332 6:94939509-94939531 GGATAAAAAAAATTACCTATTGG + Intergenic
1013390050 6:109677115-109677137 GGATACAAAAAACTACCTATTGG + Intronic
1013577219 6:111495819-111495841 GCATACCCAAAATTAACAATAGG + Intergenic
1017041573 6:150312681-150312703 GCATACACCAAGTAACCAATGGG + Intergenic
1017392554 6:153957573-153957595 GCATACACCAAGTAACCCATGGG + Intergenic
1019825995 7:3284877-3284899 AAATACAAAAAATTACCCAGGGG + Intergenic
1020404753 7:7819177-7819199 TCATACACAAATTTACCCTTAGG - Intronic
1022128926 7:27385289-27385311 GCATATACAAAATTAGAAATGGG - Intergenic
1026416700 7:70188963-70188985 GCTTACTCAAAATTTCCTATTGG - Intronic
1027752357 7:82165536-82165558 GCATAAAAAATATTAACCATGGG - Intronic
1031129217 7:117811719-117811741 GCATACAAAAAATCCCCTATAGG + Intronic
1031218842 7:118936250-118936272 ACATACAAAAAATTGCCTATGGG - Intergenic
1034021089 7:147643087-147643109 TGATTCACAGAATTACCCATGGG - Intronic
1036517340 8:9456748-9456770 CCACACACAAAATGACCCAATGG + Intergenic
1039039422 8:33393315-33393337 GTAAACACAAAATAACCCAGAGG - Intronic
1040682709 8:49832808-49832830 GCATACACCAAGTAACCAATGGG + Intergenic
1044435435 8:92157059-92157081 GCACACTCAGAATTACCCATTGG - Intergenic
1044668031 8:94650862-94650884 AAATACAAAAAATTAGCCATGGG - Intronic
1045140127 8:99271045-99271067 GCAAACACAAAATAATCCTTAGG - Intronic
1047231234 8:123000127-123000149 AAATACAAAAAATTACCCAGGGG + Intergenic
1049115703 8:140685372-140685394 ACAAACACAAAATTACAAATGGG + Intronic
1049704337 8:144033659-144033681 GCACACACATCCTTACCCATGGG + Intronic
1053180109 9:35961443-35961465 GCATGGAGAAAATTACCAATAGG - Intergenic
1055478139 9:76683890-76683912 GTATACACAAAAATATTCATGGG - Intronic
1056161065 9:83894587-83894609 GCATCCTCAATATAACCCATAGG + Intronic
1056359066 9:85834675-85834697 GCATCCTCAATATAACCCATAGG - Intergenic
1057109504 9:92454100-92454122 GAATACAAAATATTACCCACTGG - Intronic
1057356938 9:94339746-94339768 ACACACACAAAATTAGCCAAGGG + Intergenic
1058593934 9:106594799-106594821 GAATACAAAAAATTAGCCAGGGG - Intergenic
1058971587 9:110088216-110088238 GCATACACCAAGTAACCAATGGG - Intronic
1061454873 9:130690242-130690264 GCGTACACCAAATAACCAATGGG + Intergenic
1185529105 X:803083-803105 GCCTACACAAAATTGCACACGGG + Intergenic
1186242446 X:7584182-7584204 ACATATACAAAATTAACCCTGGG - Intergenic
1186325286 X:8470072-8470094 GCATTGAAAAAATTATCCATGGG + Intergenic
1186649160 X:11540490-11540512 CCACAAGCAAAATTACCCATAGG + Intronic
1189665127 X:43346367-43346389 TCACACACAAAATAACCCCTAGG - Intergenic
1193868974 X:86773686-86773708 ACATTCACACAGTTACCCATTGG + Intronic
1196543456 X:116936089-116936111 GCCAACATAAAATTTCCCATAGG - Intergenic
1198302836 X:135348434-135348456 GCATATCCAAAACTCCCCATGGG + Intronic
1198748008 X:139909490-139909512 GGATACACAAACTTATGCATGGG + Intronic
1201463036 Y:14248973-14248995 ACATACACAAAATTAACCCTAGG - Intergenic