ID: 1118175886

View in Genome Browser
Species Human (GRCh38)
Location 14:63439763-63439785
Sequence TAGGATGTCCATCATGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118175886 Original CRISPR TAGGATGTCCATCATGGAGA TGG Intronic
901521265 1:9786916-9786938 TGGGATGTGCACCAGGGAGAAGG - Intronic
902070855 1:13735652-13735674 TAGGATGTTGATAATGGGGAAGG - Intronic
910686246 1:89919536-89919558 TAAGATGTCCATTTTGCAGATGG + Intronic
914982479 1:152426809-152426831 TATGATGCCAATCATGAAGATGG + Intergenic
915772490 1:158442542-158442564 GAGGATGACCATGATGGTGATGG - Intergenic
916016029 1:160750675-160750697 CAGGATGTCCCTCTGGGAGAAGG - Intronic
916237061 1:162600605-162600627 TAGGATGTCATTCATGGGGTGGG + Intergenic
917727160 1:177839019-177839041 CAGTATGTCCATGGTGGAGAGGG + Intergenic
919755029 1:201061342-201061364 AAAGATGTTCATCATGAAGAAGG + Exonic
920175008 1:204095204-204095226 TCGGATGTCCATCTTAGAGTTGG - Intronic
921460267 1:215416792-215416814 TAGCATGGCCATCATGGATGTGG - Intergenic
923256295 1:232224286-232224308 TAGGATGTTCTTCATAGATAAGG - Intergenic
923647759 1:235841488-235841510 GAGTATTTCCATCATGGAAATGG + Intronic
1064168644 10:13008382-13008404 GAGGATGTCCATGTTGGGGAAGG + Intronic
1065298816 10:24302282-24302304 TTGGATGTCCATCATGGGTAAGG + Intronic
1069082653 10:64104800-64104822 GAGGGTATCCATCATGGAAATGG + Intergenic
1069691015 10:70352635-70352657 GGGGATGTTGATCATGGAGAAGG + Intronic
1071495858 10:86167276-86167298 GAGGATGAGCATCAGGGAGAAGG + Intronic
1073580535 10:104661453-104661475 TAGGATGCCCATGATGGTCAAGG - Intronic
1074210894 10:111334012-111334034 TAGGATGGCCACTGTGGAGATGG + Intergenic
1077472998 11:2773132-2773154 TAGAATCTCCATCATACAGAAGG + Intronic
1078682747 11:13494344-13494366 TAGGAAGTACATAATGAAGAGGG - Intronic
1078976567 11:16484617-16484639 CAGGATGTCCATCCTGGGGCTGG - Intronic
1079249068 11:18773919-18773941 AAGGATGTCCTTCATGGTCACGG - Intronic
1081245188 11:40757296-40757318 TAGGATGGGCATCTTGTAGATGG + Intronic
1082635721 11:55591009-55591031 AAGGATGTTGATAATGGAGAAGG - Intergenic
1083323965 11:61863967-61863989 CAGGATGACCCTCAGGGAGATGG - Intronic
1085879116 11:80444625-80444647 GAGGAAGCCCATGATGGAGAAGG + Intergenic
1091692798 12:2608615-2608637 GAAGATGTTCATCATGAAGAAGG - Exonic
1095415449 12:41971877-41971899 CAGGATGTCCATCATTGAGAAGG - Intergenic
1100844974 12:98648742-98648764 CAGGAATGCCATCATGGAGAAGG - Exonic
1101496377 12:105258521-105258543 TAGGCTGTCTATGAGGGAGAGGG + Intronic
1102603442 12:114050867-114050889 TTGGATGTTCCTCATGGACAAGG - Intergenic
1107202245 13:37735527-37735549 TAGTTTGTCAATGATGGAGAAGG - Intronic
1108511885 13:51163666-51163688 TCGGATGTCCTTCATAGATAAGG + Intergenic
1109546752 13:63842464-63842486 TAGGATCCCCATCCCGGAGAGGG + Intergenic
1109590714 13:64477043-64477065 TAGGATGACCATTATCAAGAAGG + Intergenic
1112181942 13:97091688-97091710 CTGGCAGTCCATCATGGAGAAGG - Intergenic
1115954493 14:38763038-38763060 TTTGATGACCATCAGGGAGAAGG - Intergenic
1116528626 14:45937736-45937758 TAAGAGGTTCATCAGGGAGAAGG + Intergenic
1118175886 14:63439763-63439785 TAGGATGTCCATCATGGAGATGG + Intronic
1119109833 14:71961096-71961118 TAGGAATTCCGTCATGGGGAGGG + Intronic
1119861665 14:77940468-77940490 TAGGAGGGTAATCATGGAGAGGG + Intergenic
1120893534 14:89509928-89509950 AAGTATGGACATCATGGAGAAGG + Intronic
1121227806 14:92334246-92334268 CAGGATGTCCAGCCTGGAGAGGG + Intronic
1122206934 14:100152309-100152331 CAGGGTGGGCATCATGGAGAAGG + Intronic
1122429154 14:101628993-101629015 CAGGGTGGCCATCATGGAGTGGG + Intergenic
1123064939 14:105613540-105613562 GAAGATGTCCATAAAGGAGAAGG - Intergenic
1123074240 14:105659183-105659205 GAAGATGTCCATAAAGGAGAAGG - Intergenic
1123094195 14:105758136-105758158 GAAGATGTCCATAAAGGAGAAGG - Intergenic
1124649029 15:31461438-31461460 TCGGATGTCCTTCATGGATAAGG + Intergenic
1124698642 15:31891029-31891051 TAGAAAGTCCATCAGGCAGAAGG - Intergenic
1125999890 15:44198767-44198789 TAGGATGCCCAGAATGGAAAGGG + Intergenic
1128432912 15:67616464-67616486 TAGGACGTCCATCAGAGACATGG - Intronic
1129970242 15:79772076-79772098 TAGGATTTCCCTCACGGGGAAGG - Intergenic
1130667775 15:85884478-85884500 TCAGATGTTCATCATGGATAAGG - Intergenic
1135956767 16:26962544-26962566 TCAGATGTCCTTCATGGACAAGG - Intergenic
1136107307 16:28039203-28039225 AAGGATGTCGACCATGGGGAAGG + Intronic
1138114725 16:54351215-54351237 TAGGGGATGCATCATGGAGATGG - Intergenic
1141860615 16:86713650-86713672 TGGGATGTGCACCATGGAAAGGG - Intergenic
1142284844 16:89167497-89167519 AGGCATGTCCAGCATGGAGACGG + Intergenic
1143616733 17:8055988-8056010 TGGGATGTCCAACATGGATGGGG - Intergenic
1146018544 17:29253654-29253676 TAAGATGACCATCTTTGAGAAGG + Exonic
1146369521 17:32256728-32256750 CAGGATGTCCTTCACGGAGAAGG + Intergenic
1147578736 17:41617038-41617060 CAGGATGTCCTGCAGGGAGATGG + Intergenic
1148371617 17:47103945-47103967 TAGGATTTCAGTCATGGAGCTGG + Intergenic
1153179916 18:2421343-2421365 AAGGATGTGCAGTATGGAGATGG - Intergenic
1153834476 18:8951605-8951627 TCGGATGTCCCTCATAGATAAGG + Intergenic
1154157445 18:11955005-11955027 TAGGATGCTTATCTTGGAGAAGG - Intergenic
1155073676 18:22337393-22337415 GAGGAAGGACATCATGGAGAAGG + Intergenic
1155764409 18:29609615-29609637 GAGGATGTTCATAATGGAGGCGG - Intergenic
1155768010 18:29660163-29660185 TATTATGTGCATCATGAAGAAGG + Intergenic
1155826225 18:30446768-30446790 TCGGATGTCCCTCATAGACAAGG - Intergenic
1156496903 18:37531691-37531713 GAGGATTTCCATCATGGAAGTGG + Intronic
1157239971 18:45999607-45999629 CAGGAAGTCCAGCATGGACAGGG + Intronic
1157650781 18:49328317-49328339 AAGGAAGTTCTTCATGGAGAAGG + Intronic
1159220087 18:65449661-65449683 TAAGATGAACATCAAGGAGAGGG + Intergenic
1160440130 18:78883475-78883497 TAGGGTGTCCTTCATGGATTGGG - Intergenic
1163830646 19:19545679-19545701 TAGGGGGGCCAGCATGGAGAAGG - Exonic
1164502669 19:28832691-28832713 TCAGATGTCCTTCATGGATAAGG + Intergenic
925483001 2:4297323-4297345 TGGGATGTTGATAATGGAGAAGG - Intergenic
925933413 2:8730148-8730170 TAGGAAGTACATAATGAAGAGGG - Exonic
925935133 2:8750258-8750280 TAGGAGGACCCTCATGTAGAGGG + Exonic
926656137 2:15408518-15408540 AAGGATGTACTTCATGAAGAAGG - Intronic
926726224 2:16000305-16000327 TAGAAAGTCCAACATGGAGCTGG + Intergenic
927073806 2:19556480-19556502 CAGCAAGTCCGTCATGGAGAAGG + Intergenic
927849852 2:26492050-26492072 GAGGATGTCCTTCATTGAAAAGG + Intronic
932399966 2:71473579-71473601 TCGGATGTCCCTCCTAGAGAGGG - Intronic
932460054 2:71876221-71876243 AAGGATGTCAATCTTGGGGAGGG + Intergenic
934545229 2:95208670-95208692 TTGGGTTTCCAGCATGGAGAAGG - Exonic
934575457 2:95397805-95397827 TGGGATGTCCATCCTGCAGGTGG - Intergenic
934976454 2:98806087-98806109 TAGTATATCCATCATGGGGTGGG + Intronic
938691118 2:133790271-133790293 CAGGATCTTCATCATGGAGAAGG - Intergenic
939917196 2:148061428-148061450 TATGATGTCAATTATGTAGAGGG - Intronic
940416339 2:153426316-153426338 CAGGATTTCCATCAAGCAGAGGG + Intergenic
943963098 2:194293030-194293052 TAGTATATCCATCTTGGAGGAGG - Intergenic
947308871 2:228778349-228778371 CAGGCTGTCCAGCAAGGAGATGG - Intergenic
949050238 2:241894098-241894120 CAGGATCTTCATCATGGAAATGG - Exonic
1169145965 20:3252524-3252546 CAGAATGTCCACCTTGGAGATGG - Exonic
1169627395 20:7587531-7587553 TAGGATTTCAACCAGGGAGATGG + Intergenic
1169850202 20:10040312-10040334 TAGGATGTCAATGACAGAGAGGG - Intronic
1170289632 20:14754198-14754220 TAGAATGGTCATCATGGAGATGG + Intronic
1172901075 20:38335351-38335373 CAGGAGGGCCATCATGGGGATGG + Intronic
1175823312 20:61923560-61923582 GTTGATGTCCATGATGGAGATGG - Exonic
1180609633 22:17086730-17086752 TGGGGTGTCCTTCATGGAAAAGG + Intronic
1181497208 22:23294155-23294177 TGGGATGTCCATAATTGAGATGG - Intronic
1183797674 22:40133539-40133561 AAGGAAGTCCACAATGGAGAGGG + Intronic
953955446 3:47228225-47228247 TAGGATGTCTATCCAGGAAAGGG + Exonic
954178725 3:48864817-48864839 TAGTATGGCCACAATGGAGATGG + Intronic
954555240 3:51512508-51512530 TAGGATGTTGATAATGGAGGAGG + Intergenic
955484825 3:59424742-59424764 CAGGCTGTCTATCAGGGAGAGGG + Intergenic
955509317 3:59663604-59663626 GAGGATGTGAATCATGAAGAAGG - Intergenic
955790404 3:62583336-62583358 TAGGATGTTCATCACAGAGGGGG + Intronic
958632711 3:96702564-96702586 TAAGTTGTCCATCATGGACCAGG + Intergenic
961165515 3:124760841-124760863 TTGGATGTCCTCCAGGGAGAGGG + Intergenic
964806113 3:160611384-160611406 CAGGTCTTCCATCATGGAGAGGG + Intergenic
966217012 3:177514383-177514405 GAAGATGTCAATCATGGAGGGGG - Intergenic
969052201 4:4380902-4380924 TAGGATTTGCGTCATGGAGAGGG - Intronic
969201636 4:5611061-5611083 GAGGATCTCCATGATGCAGAGGG - Intronic
972398556 4:38678699-38678721 TAGGATTGCTATCATGGAGGTGG + Intronic
972999515 4:44928424-44928446 CAGGATGGCCATTATGGAGTTGG + Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
977100215 4:92802225-92802247 TATGATGTTGATAATGGAGAAGG - Intronic
977704538 4:100056435-100056457 TACAATGTCTATCATGTAGAAGG + Intergenic
978594679 4:110364608-110364630 GAGGTTGTCCATGATGGAGTGGG + Intergenic
981916963 4:150044864-150044886 CAGGCTCTCCTTCATGGAGATGG + Intergenic
988123399 5:26997408-26997430 AAAGATGTCCATCTTGGAGATGG + Intronic
989468631 5:41787897-41787919 AAGGATGTCCTTCAAGCAGAAGG + Intronic
990759471 5:59112518-59112540 TAGGATGGTAACCATGGAGATGG + Intronic
993324958 5:86522929-86522951 TAGAATATTCTTCATGGAGACGG + Intergenic
994982205 5:106890059-106890081 TAGGATATTTATAATGGAGAGGG - Intergenic
997709958 5:135996031-135996053 CAGGTACTCCATCATGGAGAAGG - Intergenic
998379838 5:141716293-141716315 TAGGAGGTGCAACATGGAGGGGG + Intergenic
999650509 5:153762806-153762828 TAGGGTGTGCAACATTGAGATGG - Intronic
1001403821 5:171461995-171462017 TAGGATGTGCATTTTGTAGATGG + Intergenic
1002766686 6:246554-246576 TCCCATGTCCATCATGGTGAAGG + Intergenic
1003508985 6:6763538-6763560 TAGGGTGGCAACCATGGAGATGG + Intergenic
1003974376 6:11328856-11328878 TAGGAGGTATCTCATGGAGAGGG - Intronic
1004244433 6:13959567-13959589 TAGGATGTTGATGATGAAGATGG + Intronic
1005005608 6:21284324-21284346 TAGGAAGTCCACCAAGGAAAAGG + Intergenic
1005823170 6:29614887-29614909 GAGGATGTCGATAATGTAGAAGG + Intronic
1008044641 6:46839093-46839115 AAGGATGGCGATGATGGAGAAGG - Exonic
1014411097 6:121122215-121122237 GAGGATGTCAGTAATGGAGACGG - Intronic
1015807506 6:137126316-137126338 GAGGATTTCCAACATGCAGAAGG - Intergenic
1016430297 6:143977105-143977127 GGGGATGTCGATAATGGAGAAGG - Intronic
1019294057 7:264687-264709 CAGGATGTGCATCGAGGAGAAGG + Intergenic
1019701092 7:2475393-2475415 CAGGCTGTCCTTCCTGGAGACGG - Intronic
1020009597 7:4800768-4800790 CAGGATCACCATTATGGAGAGGG - Intronic
1020392541 7:7674152-7674174 GAGGAGGTCCAGCATGGAAAAGG - Intronic
1021290306 7:18835464-18835486 TAGGATGTTCACCATGGAAACGG + Exonic
1022106584 7:27201253-27201275 TAGGATCTCCAGCCTGCAGAGGG + Intergenic
1022235969 7:28460608-28460630 TGGGGTATCCATCATGAAGATGG + Intronic
1027661316 7:80991272-80991294 TAGGGACTGCATCATGGAGATGG - Intergenic
1028102997 7:86844670-86844692 TAGGATGTTAACAATGGAGATGG + Intronic
1028857785 7:95611599-95611621 AAGGATGTCCCACTTGGAGAAGG - Intergenic
1030542414 7:110847272-110847294 TAAGATGTACAACATGGATAAGG + Intronic
1031949328 7:127875734-127875756 CAGGATGTCCACCATGGAACAGG - Intronic
1032973578 7:137194695-137194717 TAGAAGGTCTATCTTGGAGAAGG - Intergenic
1033230044 7:139589697-139589719 TTGGGTTTCCATCAAGGAGATGG - Intronic
1038641257 8:29330772-29330794 TAGGATGTATATGATGGACATGG - Intergenic
1039536004 8:38313415-38313437 TATGATTTCCATTATGCAGAAGG - Intronic
1041399609 8:57428226-57428248 TAGCCTGACCAACATGGAGAAGG - Intergenic
1041677597 8:60551062-60551084 CAGGTAGTCCCTCATGGAGAAGG - Intronic
1042252174 8:66767476-66767498 TTGGATTTCCATGGTGGAGAGGG + Intronic
1044721956 8:95159707-95159729 GAGGATGTCCATGTGGGAGAGGG - Intergenic
1047157317 8:122333898-122333920 TAGGATGTTCATCTTGGATAAGG + Intergenic
1050041213 9:1495848-1495870 GAGGATGGACATCATGGAGTGGG + Intergenic
1050178193 9:2891356-2891378 AAGCATGTCCTTCATTGAGATGG - Intergenic
1050191133 9:3027588-3027610 TACGATCTCCATCATACAGATGG + Intergenic
1050828365 9:9979131-9979153 GAGGATGTCCTTCAGGCAGAAGG + Intronic
1051509677 9:17863585-17863607 CAGGATGTCCTTCATGGAGCAGG + Intergenic
1051877158 9:21804962-21804984 TAGAATGTCCATCTTGAAGAGGG + Intronic
1053652952 9:40187813-40187835 AAGGATGGCAATGATGGAGAAGG + Intergenic
1054531631 9:66188408-66188430 AAGGATGGCAATGATGGAGAAGG - Intergenic
1055769272 9:79699788-79699810 TAGAAAGTCCATTGTGGAGATGG + Intronic
1056525945 9:87443204-87443226 GAGCATTTCCATCATGGAAAGGG - Intergenic
1057217046 9:93234878-93234900 TGGGATGTGCATGCTGGAGATGG + Exonic
1059748748 9:117228543-117228565 TAAGATGCCCATCAATGAGAAGG + Intronic
1059797763 9:117717825-117717847 TAGAATTTCCATCTGGGAGAGGG - Intergenic
1062559969 9:137137111-137137133 CAGGTTGTCCATGATGGAGATGG - Intergenic
1192604046 X:72495155-72495177 TTGGATCTGCACCATGGAGATGG - Exonic
1197459664 X:126724449-126724471 TAGTATGGCCGTCATGCAGACGG - Intergenic
1200777452 Y:7182065-7182087 CAAGGAGTCCATCATGGAGAAGG + Intergenic