ID: 1118177567

View in Genome Browser
Species Human (GRCh38)
Location 14:63456883-63456905
Sequence CTGTGTTAATTCTTGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118177567 Original CRISPR CTGTGTTAATTCTTGGTGCA TGG (reversed) Intronic
901021613 1:6258846-6258868 ATGTGTTGATTACTGGTGCAGGG + Intronic
904809043 1:33151413-33151435 CTGTGTTAATGATTCGTGCAAGG - Intronic
907942670 1:59104571-59104593 CTGAGTTCACTCTTGGTTCAGGG + Intergenic
908636461 1:66171908-66171930 CTGAGTTAATTCTTTGGACAAGG - Intronic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
918219981 1:182427929-182427951 CTTTGTTTCTTCTTGGGGCATGG - Intergenic
918652040 1:186977382-186977404 TTATGTTAATTCTTGGCACAAGG - Intronic
920405923 1:205710612-205710634 CTGTGTTAATTCTGGGGTCAGGG - Intergenic
924069897 1:240265959-240265981 CTGTGATAAGTCTTTGTCCATGG + Intronic
924086614 1:240458154-240458176 TTGTGTTTATTTTTGGTGCTGGG + Intronic
1064276959 10:13915318-13915340 ATGTGTTAAGTGCTGGTGCATGG + Intronic
1065186148 10:23172741-23172763 CTGGATTAATGCTTGGTGCCAGG + Intergenic
1065869005 10:29940207-29940229 CTTGGTTACTTCTTGGTTCATGG - Intergenic
1066230502 10:33428091-33428113 CTGTTTTAATTCTTAATTCAAGG + Intergenic
1068484236 10:57636134-57636156 CTGTGTCATTTCATGGTGGAAGG + Intergenic
1071307795 10:84314397-84314419 CTGAGTTGCCTCTTGGTGCAGGG - Intergenic
1072637383 10:97186483-97186505 CTGTGTCAATTCTTGGTTAAGGG + Intronic
1074004786 10:109410325-109410347 CTTTATTAATTCTGGGTGCATGG - Intergenic
1079394391 11:20049388-20049410 CTGTGGTTATTTTTGGTGCTTGG + Intronic
1079792585 11:24756662-24756684 CTGTGTTAATTGTTGTGGTATGG - Intronic
1079879903 11:25913672-25913694 TTGTCTAAATTCTTGTTGCAGGG + Intergenic
1082892197 11:58151790-58151812 CTGGGGTAATTCTGTGTGCAAGG - Intronic
1085976316 11:81659933-81659955 CTGTGTGTTTTCTAGGTGCATGG + Intergenic
1086425157 11:86675618-86675640 CTGAGTTAATTCTAAGTGCCAGG - Intergenic
1087807123 11:102567328-102567350 CTGTGTTTATTCTTGACTCATGG + Intergenic
1091315817 11:134613376-134613398 CTGTGTTTCTTCTTGGTGGAGGG - Intergenic
1094573686 12:31664411-31664433 CAGTCTTAATTCGTGGTGCTCGG + Intronic
1095140239 12:38653818-38653840 CTGAGTTAATGCTTTGTGCCTGG - Exonic
1097676274 12:62605200-62605222 CTGTGTCAAATCTTGGTTTATGG + Intergenic
1098411812 12:70193916-70193938 CTGTCTAAATTCTTTGTGAAAGG - Intergenic
1099621319 12:85005724-85005746 CTGTGGTTTTTCTGGGTGCACGG - Intergenic
1099762184 12:86938487-86938509 CTGTTTTAGTTCTTGTAGCAGGG - Intergenic
1102279751 12:111609555-111609577 CTGGATTAATTCTTTGTGCTGGG - Intergenic
1106105291 13:26727820-26727842 CTGTGTTAGTTCAAGGTGAAGGG + Intergenic
1107073264 13:36294790-36294812 CTGTTCTAATTACTGGTGCATGG - Intronic
1107544003 13:41420149-41420171 ATATGTTAATTCTTGGTGGTGGG + Intergenic
1111242181 13:85489365-85489387 GTGTGTTTATTATTGTTGCATGG + Intergenic
1111549937 13:89795120-89795142 CTGAGTTAATTTTTTGTGTAAGG + Intergenic
1114197503 14:20491725-20491747 ATGGGGTGATTCTTGGTGCAGGG + Intergenic
1115142226 14:30185180-30185202 CTGTGTTAATTATTCTTGCTTGG + Intronic
1118177567 14:63456883-63456905 CTGTGTTAATTCTTGGTGCATGG - Intronic
1120238522 14:81921989-81922011 TTGAGTTAATTTTTTGTGCAAGG - Intergenic
1121485630 14:94312445-94312467 CTTGTTTAATGCTTGGTGCATGG - Intronic
1125467601 15:39969808-39969830 CTGTTTTCATTCTTTGTGAATGG - Intronic
1127169890 15:56290342-56290364 TTGTGCTGATTCTTGCTGCATGG + Intronic
1130746896 15:86663982-86664004 CTGTGGTCATTCATGGTGTAGGG + Intronic
1131932017 15:97453389-97453411 CTGGCTTCATTCTTGGTCCAGGG + Intergenic
1131933356 15:97472048-97472070 TTGTGTAAAATCTTGGTCCAAGG - Intergenic
1133281465 16:4667881-4667903 CTGTCTTGATTCTTGCTGCCAGG + Intronic
1134557279 16:15176329-15176351 CTGTGTCTATTCTTTGTGCCTGG - Intergenic
1134917854 16:18088038-18088060 CTGTGTCTATTCTTTGTGCCTGG - Intergenic
1138816664 16:60210676-60210698 CTGTCTTAACTCTTGTTGCCTGG + Intergenic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140690731 16:77480957-77480979 CTGTGTAGATTCTGGGTACATGG + Intergenic
1142744095 17:1946805-1946827 CTGTGTGAATTGTGTGTGCACGG + Intronic
1144508825 17:15857472-15857494 CTGTGGTTTTTCTGGGTGCACGG - Intergenic
1145172941 17:20675112-20675134 CTGTGGTTTTTCTGGGTGCACGG - Intergenic
1147439545 17:40439354-40439376 CTGTGCTGATTCTTGTAGCATGG + Intergenic
1150041146 17:61863068-61863090 CTGCGTTAATTCTTGGCGGGAGG - Intronic
1153038317 18:785988-786010 CTGTGTTATCTCATGGTGGAAGG - Intronic
1159398367 18:67894871-67894893 CTGTGTTAATTCTTTTTTTAAGG - Intergenic
1159536232 18:69718404-69718426 CAATGTTACTTCTTGTTGCATGG - Intronic
1160477501 18:79205650-79205672 CTGTGTTACTTCTAGATGCAGGG + Intronic
1162891121 19:13733847-13733869 CTCTTTTAATTCTTGGCTCATGG - Intronic
1164413882 19:28029698-28029720 CTTTTTTAAATGTTGGTGCAGGG + Intergenic
1164714942 19:30384414-30384436 CTGTGTTAATGCTGGGGGCCTGG + Intronic
1166250658 19:41568447-41568469 TTGAGTTAATTTTTTGTGCATGG + Intronic
926905786 2:17804481-17804503 CTGTGATTATTCTTATTGCAAGG - Intergenic
927850973 2:26499069-26499091 ATGTATTAAGTCTTGGTGCCAGG + Intronic
928481550 2:31689320-31689342 TTGTGTTAATTCCTGTTGAAAGG + Intergenic
929222961 2:39484365-39484387 CTGTGTTATTCCATGGTGGAAGG - Intergenic
929345437 2:40877786-40877808 ATATGTTAATTTGTGGTGCAGGG + Intergenic
931860915 2:66353539-66353561 CAGTGTGAATTCTTGGAGGATGG - Intergenic
933397845 2:81754606-81754628 CTGTGTCTTTTCTAGGTGCATGG + Intergenic
933885064 2:86711636-86711658 CTGTGCCTATTCATGGTGCAGGG + Intronic
933925109 2:87085048-87085070 CTGTGCCTATTCATGGTGCAGGG - Intergenic
937948336 2:127363013-127363035 CTGTGTAAATTATTGTTACACGG - Intronic
939424779 2:142020742-142020764 GTGTGTGAATTCTTGGTTCATGG + Intronic
942303865 2:174587522-174587544 CTGTCTTAATTCTTGTTTCCCGG - Intronic
944491567 2:200263109-200263131 CTGTGGTTTTTCTAGGTGCATGG - Intergenic
945447886 2:209959724-209959746 CTGTGTTCACACTTGGGGCAGGG - Intronic
947632829 2:231665110-231665132 CTGTTTTAATTCAAGATGCACGG - Intergenic
1172754997 20:37277282-37277304 CTCTGTTCTTTCTTGCTGCATGG + Intergenic
1174442309 20:50566081-50566103 TTGAGTAAGTTCTTGGTGCATGG + Intronic
1175671968 20:60911084-60911106 CTGAGCTATTACTTGGTGCAAGG - Intergenic
1178426445 21:32482688-32482710 CTGTGTTCATTGTTTGTGCCTGG - Intronic
1184203596 22:42986099-42986121 CTGTGTTAATTCTGGGGAAAGGG - Intronic
1184445689 22:44545540-44545562 CTGTGCTCACTCTGGGTGCAGGG + Intergenic
950450873 3:13064797-13064819 CTGTGTGGATTCTTGGTGTGGGG + Intronic
952412476 3:33062120-33062142 CTGTCTTAATTCATGTTGAAGGG - Intronic
952475253 3:33702948-33702970 TTGAGTTAATTTTTGGTGAAGGG - Intronic
952742053 3:36743505-36743527 CTGTGTTACTTCCTGGGACATGG - Intergenic
956562726 3:70598962-70598984 GTGTGTTAATTCTAGGTGAGGGG + Intergenic
956670692 3:71686738-71686760 CTGTGTTACTTCTAGGTGTGAGG + Intronic
959263320 3:104107435-104107457 CTGTGCTATGTGTTGGTGCAAGG - Intergenic
959859112 3:111196557-111196579 CTGTTTTGATTCTTGGTAAATGG - Intronic
960007365 3:112793966-112793988 CTGAGTTTCTTCATGGTGCAGGG + Intronic
962449216 3:135497916-135497938 CTGTGTGAATCCTTGGTGCAGGG + Intergenic
964730151 3:159856449-159856471 ATGTGTACATTCTTGGGGCAGGG + Intronic
966174959 3:177128289-177128311 CTGTTTTATTTCTTGGTAAATGG + Intronic
967580799 3:191151243-191151265 CTGTATAAATTCCTAGTGCAAGG - Intergenic
972038766 4:34561996-34562018 TTGTGTTAGTTCTTGCAGCATGG - Intergenic
975582115 4:75916342-75916364 CTGTGTTAATTCTGGCTCCATGG + Intronic
977269690 4:94901058-94901080 TTCTGTTAATACTTTGTGCAGGG + Intronic
977320125 4:95503254-95503276 CTGTGTTATTCCATGGTGAAAGG - Intronic
979454878 4:120915922-120915944 CTGTGTTATTTTTTGGTGCTGGG - Intronic
979544021 4:121919504-121919526 CTCTGTTATCTCTTGGTGCCTGG + Intronic
981119801 4:141037015-141037037 CTGTGTTAAATATTGGATCAAGG - Intronic
983495848 4:168441814-168441836 CTTTGTTAATTTTTTGGGCAGGG - Intronic
983709070 4:170692636-170692658 CTGTGTTGATTGTTGTGGCATGG - Intergenic
984456157 4:179972030-179972052 CTGTGTTAATTCCTTGAGAATGG + Intergenic
984709054 4:182869770-182869792 CTGTGGTAATTCCGGGTCCAGGG + Intergenic
986228246 5:5837329-5837351 CTGTCTTAATACTAGGTGAAGGG - Intergenic
986613457 5:9592808-9592830 CTGTGTTTCTTCTGGTTGCAAGG + Intergenic
989456055 5:41645830-41645852 CTGTGTTAATACTTGTCCCAAGG + Intergenic
989665846 5:43853146-43853168 CTTCTTTAATTCCTGGTGCAAGG - Intergenic
990625461 5:57605469-57605491 CTGTACTGACTCTTGGTGCAAGG - Intergenic
1001517830 5:172368416-172368438 CTGTGATATGTTTTGGTGCAAGG + Intronic
1004769582 6:18766964-18766986 CAGGGTTAACTCTTGGTCCATGG + Intergenic
1007912846 6:45533540-45533562 TTGAGTTAATTCTGTGTGCAGGG + Intronic
1011553697 6:88552566-88552588 ATGTGTTAAATATTGGTGGATGG - Intergenic
1012688273 6:102280051-102280073 TTTTGTTTATTCTTGTTGCATGG - Intergenic
1014193592 6:118526332-118526354 CTGTGTTATTTGTTGGATCATGG - Intronic
1016879462 6:148896778-148896800 TTCTGTTCATTCTTGGTGCCTGG + Intronic
1016961521 6:149677180-149677202 CTGTGTTGATTCTCTGTGTAGGG - Intronic
1017148848 6:151259915-151259937 CATTGTTAATGCTTTGTGCAAGG - Intronic
1017236622 6:152123148-152123170 CTGTTTTTATTTTTGCTGCATGG - Intronic
1017345885 6:153380208-153380230 TTGTGTTATTTTTTGGTGTAAGG - Intergenic
1023606253 7:41933832-41933854 CAGTGTTAAATCTTGGGTCAGGG - Intergenic
1024214357 7:47234631-47234653 CTGTGCTACTTCTTAGTGCTTGG + Intergenic
1025092705 7:56076907-56076929 CTCTGTCAATGCTTGGTGAAAGG - Intronic
1026788138 7:73314509-73314531 CGGTGTTAATTCCTGCTCCAAGG - Intronic
1027877369 7:83787772-83787794 CTTTGTTTCTCCTTGGTGCAGGG - Intergenic
1029232198 7:99079425-99079447 CTGTGTTCATTCTTGCAGCTGGG - Intronic
1030479031 7:110078640-110078662 ATGTGTTCATTGTAGGTGCACGG + Intergenic
1031028983 7:116713922-116713944 CTGTTTTATTTGTTAGTGCAGGG + Intronic
1031418062 7:121517144-121517166 CTGTGTTAGCTCATGGTGGAAGG + Intergenic
1033566155 7:142580242-142580264 TTATGTTAATTCTTTGGGCATGG - Intergenic
1038155433 8:24985052-24985074 TTGTGTTAAGCCTTGGTGGAAGG + Intergenic
1041719039 8:60959899-60959921 CTGTGTCATTTCATGGTGGAAGG + Intergenic
1043698348 8:83251116-83251138 CTGTGTGCATTCTCTGTGCATGG + Intergenic
1043851878 8:85225160-85225182 CTGTGACATTTATTGGTGCAAGG - Intronic
1044921292 8:97172182-97172204 ATGTGTCCATTCTTGGTGCTAGG + Intergenic
1051660796 9:19424602-19424624 CTGTGTTAACCATTGGTGAAAGG + Intronic
1052358001 9:27526016-27526038 CTCTGTTAATTCTTGCTTGAAGG - Exonic
1186757986 X:12693233-12693255 CTGTGTTGGTTCATGCTGCATGG + Intronic
1191578028 X:62728488-62728510 CTGTGAAACTTCTTGGTGAAGGG - Intergenic
1193349949 X:80451813-80451835 CGGTGTTATTTTTTGGTACATGG - Intergenic
1194607587 X:96000366-96000388 CTGTGTCAGTTCATGGTCCAGGG + Intergenic
1196569559 X:117249433-117249455 CTGTGTTAATGCTTGGAAAAAGG + Intergenic
1198405102 X:136304569-136304591 CTGTGCTAACTCCTGGGGCAGGG + Intronic
1198420898 X:136470132-136470154 CTGTTTTAATTGGTGGTGCTGGG + Intergenic
1199170902 X:144733412-144733434 CTGTGATTTTTCTGGGTGCATGG + Intergenic