ID: 1118178414

View in Genome Browser
Species Human (GRCh38)
Location 14:63465820-63465842
Sequence GCTGACTCTCAGGCACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118178414_1118178416 4 Left 1118178414 14:63465820-63465842 CCAGGATGTGCCTGAGAGTCAGC 0: 1
1: 0
2: 0
3: 12
4: 192
Right 1118178416 14:63465847-63465869 CTGAAGCCCAATTTTCAGTCAGG 0: 1
1: 0
2: 2
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118178414 Original CRISPR GCTGACTCTCAGGCACATCC TGG (reversed) Intronic
900462888 1:2809842-2809864 GCTCTCGCTCAGGCAGATCCAGG - Intergenic
901637080 1:10675508-10675530 GCTCAGCCTCAGGCACTTCCGGG + Intronic
903968863 1:27106292-27106314 GATGTCTCTAAAGCACATCCAGG - Intronic
908119306 1:60970790-60970812 GCTGACTGTGATACACATCCAGG - Intronic
910433392 1:87180612-87180634 GCAGAGTCTCAGGCCCCTCCAGG + Intergenic
911968314 1:104396463-104396485 ACTAACTCTCTAGCACATCCTGG + Intergenic
915141752 1:153772370-153772392 GCTGACTCTGGAGCAGATCCTGG + Exonic
918313161 1:183301188-183301210 GCTGAATCTCAGGCAAAGCCTGG - Intronic
920290684 1:204921086-204921108 GCTGTCACTCAGGAGCATCCAGG - Intronic
921075521 1:211697525-211697547 GCAGACTCTCAGGCCCCACCCGG + Intergenic
921080468 1:211735252-211735274 ACTGACTCCCTGGCACATGCAGG - Intergenic
921556208 1:216601289-216601311 GCAGACTCCCAGGGACTTCCTGG + Intronic
924625481 1:245693764-245693786 TTTGGTTCTCAGGCACATCCTGG + Intronic
1062992993 10:1837309-1837331 GCTCCCTCACAGACACATCCAGG - Intergenic
1063947333 10:11191011-11191033 GCTGACCTTCATGGACATCCTGG + Intronic
1068663298 10:59646589-59646611 GCTGATTCTCAGACTCATGCAGG + Intergenic
1071329311 10:84544362-84544384 GCTGCCTCTCCGACCCATCCCGG + Intergenic
1071602396 10:86964732-86964754 GGGGACTCTCGGGCACACCCAGG - Intronic
1072570482 10:96653994-96654016 GCAGAGTCTCAGGCCCCTCCTGG + Intronic
1073842165 10:107510148-107510170 GCTGATCTTCAGGCACATTCTGG + Intergenic
1074755518 10:116621505-116621527 GTTGACTCTCAGGCAGACACAGG + Intronic
1075870702 10:125771099-125771121 CCTGGTTCACAGGCACATCCTGG + Intronic
1076420033 10:130324763-130324785 GCTGCCTCTCAGGGATCTCCTGG - Intergenic
1076690244 10:132220012-132220034 GGTGAATATCAGCCACATCCTGG + Intronic
1076791802 10:132780765-132780787 GCTGACTGGCAGGAACATCAGGG - Intronic
1077414636 11:2419111-2419133 GGTGATTCTAAGGCACCTCCAGG - Intronic
1077919509 11:6632157-6632179 GCTGGTTCTCAGCCACAGCCAGG + Exonic
1078538719 11:12196495-12196517 GCTGAGCCCCAGGCACTTCCAGG + Intronic
1079309250 11:19349843-19349865 GCAGACACTCAGTCACCTCCCGG - Intergenic
1080101589 11:28466106-28466128 GCTGGGTCTCAGGAACAGCCAGG + Intergenic
1080663843 11:34318571-34318593 GCTGAGACTCAGGTCCATCCTGG - Intronic
1081801963 11:45866188-45866210 GCTGCCTCTCAGGCAGCTCAAGG - Intronic
1081823476 11:46023260-46023282 GCTGTCTCTCTGCCAGATCCCGG - Intronic
1083160666 11:60852322-60852344 GGTGATTCACAGGCACATCAAGG + Exonic
1083675542 11:64322921-64322943 GCTGCCTCTCAGCCACCTACAGG + Intergenic
1085336997 11:75703882-75703904 GCTGACTCTCTAGCAATTCCTGG + Intergenic
1089048911 11:115528898-115528920 GGTGACTCTTATGCATATCCAGG - Intergenic
1089402552 11:118172707-118172729 GCTGTCTCCAAGGCACATCTGGG + Intronic
1089848788 11:121479624-121479646 GCTGAATTTCAGGGAGATCCTGG + Intronic
1090283871 11:125481786-125481808 ACTGAATCAGAGGCACATCCAGG + Intronic
1091370218 11:135051380-135051402 GCTGTCTCCCAGGGACTTCCAGG + Intergenic
1093289229 12:17301087-17301109 GCTGACTCTTAGGCAAAAGCTGG + Intergenic
1097842700 12:64337499-64337521 GCTGTCTCTCAAGCACCTTCAGG - Intronic
1101740738 12:107497957-107497979 ATTGAGTCTGAGGCACATCCTGG + Intronic
1104280763 12:127374363-127374385 ACTGAGGCTCAGGGACATCCAGG + Intergenic
1104868346 12:131975177-131975199 GCTGAGTGTCAGCCACAGCCGGG + Intronic
1107860084 13:44652268-44652290 TCTGACTCTCAGGGAGGTCCTGG - Intergenic
1112416720 13:99209037-99209059 GCTGGCTCTCGCGCACAGCCTGG + Intronic
1112763680 13:102718425-102718447 GCCAACTCTAAGCCACATCCGGG + Intergenic
1113367936 13:109695192-109695214 GTTGACTCTGAGGCCCAGCCAGG - Intergenic
1113880795 13:113624297-113624319 GGTGTCTCTCAGGCATACCCAGG + Intronic
1115534035 14:34355832-34355854 GCTGTTTCTCAGCCACAGCCTGG + Intronic
1118178414 14:63465820-63465842 GCTGACTCTCAGGCACATCCTGG - Intronic
1122605661 14:102945964-102945986 GCTGACCCTCAGGCTTAGCCGGG + Intronic
1122713697 14:103680123-103680145 GCAGCCTCTCAGGCACATGGCGG - Intronic
1123932895 15:25180391-25180413 GCTGAAGCTCAGGCCCTTCCTGG + Intergenic
1123935330 15:25191301-25191323 GCTGAAGCTCAGGCCCTTCCTGG + Intergenic
1123945709 15:25237883-25237905 GCTGAAGCTCAGGCCCTTCCTGG + Intergenic
1124142555 15:27089474-27089496 GGTGACTCTAGGGTACATCCGGG + Intronic
1124795329 15:32772823-32772845 GCTGGCTGGCAGGCATATCCTGG + Exonic
1125725282 15:41865290-41865312 GCTGATTATCTGCCACATCCAGG + Intronic
1128670639 15:69572410-69572432 ACTAACTCTCAGGCACATTCTGG - Intergenic
1129523284 15:76198995-76199017 GCTCTGTGTCAGGCACATCCCGG + Intronic
1131348907 15:91678627-91678649 GCTGATTCCCATGCTCATCCAGG + Intergenic
1131814617 15:96209312-96209334 ACTGAGCCCCAGGCACATCCAGG + Intergenic
1132220868 15:100104101-100104123 GCTGGGTCTCAGGTACATCTGGG + Intronic
1132385182 15:101395313-101395335 GCACACTCTCAGGCCCACCCTGG - Intronic
1132950908 16:2562060-2562082 GCAGACTCCCAGCCACACCCTGG - Intronic
1132963441 16:2638110-2638132 GCAGACTCCCAGCCACACCCTGG + Intergenic
1135351528 16:21733443-21733465 GGTGACTCTTAGGTACAGCCAGG + Intronic
1135450010 16:22549571-22549593 GGTGACTCTTAGGTACAGCCAGG + Intergenic
1140797788 16:78456170-78456192 TCTGAATCTCAGACACAACCTGG - Intronic
1141602598 16:85135505-85135527 TCTGACTTTCTGGCCCATCCAGG - Intergenic
1141674933 16:85512859-85512881 GCTGACTCACAGGGACAGCTGGG + Intergenic
1142593976 17:1020761-1020783 GCTGAGTTTCAGGAACATCCTGG + Intronic
1142693733 17:1621975-1621997 GCTGGCTCTCAGGGACCTCGTGG - Intronic
1142932543 17:3299247-3299269 GCTGACTCTCAGGCTTGCCCTGG + Intergenic
1143110516 17:4550266-4550288 GCTGCCGCTCAGGGTCATCCTGG + Exonic
1143307359 17:5958073-5958095 GCTGCCTCTCAGGCAGTCCCAGG - Intronic
1144447216 17:15341931-15341953 GCCGATTCTAAGGCACATCAGGG + Intergenic
1145760121 17:27420923-27420945 GCTGACTCCCAGGAAGGTCCAGG - Intergenic
1147169057 17:38607480-38607502 GCTGCCTCCCATGCCCATCCTGG - Intergenic
1148124174 17:45228436-45228458 GCTGACTCTGAGCCACCACCTGG - Intronic
1151449702 17:74190991-74191013 GCTGACCCACAGGCCCAGCCTGG + Intergenic
1151980107 17:77503539-77503561 GCTTTCTCCCAGGCGCATCCAGG - Intergenic
1156762483 18:40610084-40610106 GCTGTCTCTCAAGTATATCCTGG + Intergenic
1157678286 18:49583727-49583749 GCTGAATATCAGGCGCATCCGGG + Exonic
1158153235 18:54395363-54395385 CTTGACTCTCAGACAGATCCCGG + Intergenic
1159246166 18:65808021-65808043 GCCAACTCTCTGGCAGATCCAGG - Intronic
1160022512 18:75191417-75191439 TCTGACTTGCAGGCACATGCAGG + Intergenic
1160397392 18:78582601-78582623 GCAGTCTCTCTGGCACACCCCGG - Intergenic
1160712448 19:558803-558825 CCTGACCCTCAGGCAGAGCCAGG - Intergenic
1163623207 19:18372954-18372976 GCAGCCTCTCAGCCATATCCTGG - Intergenic
1164470505 19:28526277-28526299 GCTGACTCTCTAGCACAGCTAGG - Intergenic
1164745151 19:30606690-30606712 GTTGACTCCCAGGCACAAACGGG + Intronic
1165441181 19:35828959-35828981 GCTGATGCTCTGGCACCTCCTGG - Intronic
925399687 2:3563380-3563402 GCTGACTCTGAGGCACCATCAGG + Intergenic
925461876 2:4070261-4070283 GCCGGCATTCAGGCACATCCGGG + Intergenic
927248544 2:20978020-20978042 TCTGATTCCCAGGCACTTCCTGG - Intergenic
927918220 2:26950135-26950157 GCTGAGGCGCAGGCACAGCCTGG + Exonic
928359338 2:30650024-30650046 GGTGATTCTCACGCACAGCCAGG + Intergenic
929594582 2:43168307-43168329 TCTGCCTCTCAAGAACATCCTGG + Intergenic
929974428 2:46617728-46617750 GCTTACTCTAAGCCATATCCTGG - Intronic
930075131 2:47400396-47400418 GCTGATTGTCAGGAACATCCAGG + Intergenic
930143762 2:47980383-47980405 GGTGACTCTGATGTACATCCAGG - Intergenic
931852133 2:66262434-66262456 GCAGAATCTCAGGCCCATCCTGG + Intergenic
934989693 2:98912622-98912644 GCTGACTCTCAGCCCCCGCCTGG + Intronic
939445382 2:142303497-142303519 CCTGACTTTCAGGCTTATCCTGG + Intergenic
942251804 2:174053735-174053757 GCTGACTCTCAAGCAAAGGCTGG + Intergenic
945548102 2:211183296-211183318 GCTGACTCTAAGGAAAATCAGGG - Intergenic
945746920 2:213729502-213729524 GCTGACATTCAGGCTCCTCCTGG - Intronic
947915629 2:233830275-233830297 GCTGCCTCTCAGGCTAACCCCGG + Intronic
948800056 2:240429465-240429487 GGTGACTCTCAGGCAGGTGCAGG - Intergenic
948814224 2:240501773-240501795 GCTGACTCCCTGGCACATGGGGG + Intronic
1169317292 20:4603117-4603139 GCTGATTCTCTGGCACAGCTAGG + Intergenic
1169783395 20:9332913-9332935 GGTGACTTTGAGGCACGTCCTGG - Intronic
1171233423 20:23505776-23505798 GCTGAATCTCGTGCCCATCCTGG + Intergenic
1171252913 20:23663097-23663119 CCAGACTCACAGGCCCATCCTGG + Intergenic
1171259398 20:23718414-23718436 CCAGACTCACAGGCCCATCCTGG + Intergenic
1172359735 20:34303535-34303557 GCTGGCTCTCAGGCCTCTCCCGG - Intronic
1174619805 20:51865338-51865360 GCTGATTCTCAAGTACAACCAGG - Intergenic
1175130938 20:56789052-56789074 GCTGTGTCCCAGGCCCATCCTGG + Intergenic
1176139873 20:63540271-63540293 GCTGACTCCCAGGCAGACCGTGG - Intergenic
1178909904 21:36666109-36666131 GCAGACCCTCAGGCCCCTCCTGG + Intergenic
1181111856 22:20607092-20607114 CCTGACTCCCAGGCCCATCGGGG - Intergenic
1181325539 22:22043059-22043081 CCTGCCTCTCTGCCACATCCGGG - Intergenic
1181577373 22:23803499-23803521 GCTGCCTGTCAGGCAGATTCTGG + Intronic
1182008872 22:26983823-26983845 CCTCACTCTCCGGCACATACAGG - Intergenic
1182098792 22:27643500-27643522 GCTGCCTCTCAGACCCTTCCTGG - Intergenic
1182535062 22:30994862-30994884 CCACACTCTCAGACACATCCAGG + Intergenic
1183315823 22:37136360-37136382 GCTGACTCTCAAGCAGAAGCAGG - Exonic
1183354796 22:37352365-37352387 GCTGTGTGTCAGGCACATGCTGG + Intergenic
1183356697 22:37363646-37363668 GCTGCCTCTCCGGCATATGCTGG - Intergenic
1183374841 22:37457193-37457215 GTTGCCTCTCAGGCACATGCTGG - Intergenic
1184179880 22:42813609-42813631 GCTGCCTCACAGGCTCATGCTGG - Intronic
950437342 3:12987972-12987994 GCTGTCTCTGGGGCACATACTGG - Intronic
950669981 3:14520134-14520156 GCTGACTCTGGGGCACAGGCAGG + Exonic
953753008 3:45623796-45623818 GCTGACTCTAGTGCACAGCCAGG - Intronic
960682660 3:120265185-120265207 TCTGACTCTCAGGTACAAGCTGG + Intronic
961057475 3:123801257-123801279 GAAGAGTCTCAGGGACATCCAGG + Intronic
962409354 3:135127867-135127889 CCAACCTCTCAGGCACATCCTGG + Intronic
962750811 3:138433923-138433945 ATTGACTCTCAGGCACCTCGGGG + Intergenic
967601555 3:191396265-191396287 GCTGACTGTCAGTCACATAAAGG - Intronic
968230041 3:197000128-197000150 GCAGACTCTCAGTCTCATGCTGG + Intronic
968910019 4:3472882-3472904 GCTGAAGCTCAGCCACAACCTGG + Intronic
971361369 4:25941272-25941294 GCTGACTTTGAGGAATATCCTGG + Intergenic
976643736 4:87365533-87365555 GCTGACTCTCCAGCATAGCCAGG - Intronic
976788778 4:88853702-88853724 ACTGACTCACAGACACACCCAGG - Intronic
976963825 4:91011554-91011576 TCTGACTCTAAGGCACCCCCTGG + Intronic
984650601 4:182266073-182266095 GCTGACTCTCCAGCACAGCTAGG - Intronic
989636428 5:43540909-43540931 GGTAACTCTAAGGCACAGCCGGG + Intronic
990769508 5:59227031-59227053 GCTGACTCTCAGGTCCAGCCTGG - Intronic
990861529 5:60333003-60333025 GCTGGCTCTAAGGCAGATGCAGG + Intronic
994174845 5:96700518-96700540 GCAGAATCTCAGCCTCATCCTGG - Intronic
994856246 5:105123550-105123572 GCTGACTCTGAGGCTCATGATGG - Intergenic
997529683 5:134574140-134574162 ACTGACTCCCAGGCACACCAGGG - Intronic
997791518 5:136766580-136766602 GCTGGCGCTCAGGCAGATGCAGG - Intergenic
999474798 5:151888721-151888743 GGTGAGTCTCATGCACAGCCAGG + Intronic
1000336787 5:160247202-160247224 CCTGACTCTAAGCCAAATCCAGG + Intergenic
1002079945 5:176731743-176731765 CCTGGGTCTCAGGCCCATCCTGG - Intergenic
1003854687 6:10261162-10261184 GCTGCTGCTCTGGCACATCCAGG - Intergenic
1004065841 6:12242968-12242990 GTTGACTCTTAGGCAGCTCCAGG + Intergenic
1005390630 6:25329602-25329624 GCTTCCTCTCAGCCATATCCTGG - Intronic
1005844582 6:29767442-29767464 GCTCACTCTCAGCCTCCTCCTGG + Intergenic
1005968360 6:30742801-30742823 GCTGGCTCTCGGGCCCAGCCGGG + Intergenic
1006083272 6:31579767-31579789 GCTGACTTTCAGCCACAGGCTGG - Intergenic
1006441075 6:34053972-34053994 GGTGACTCTAACGCACCTCCAGG + Intronic
1007383013 6:41502853-41502875 GCTGCCTCTCATCCACTTCCGGG + Intergenic
1011281051 6:85678431-85678453 GCCGCCGCTCAGGCACATGCCGG + Intergenic
1015382829 6:132589218-132589240 GGTGGCTCTCAGGTACATCCTGG - Exonic
1016871836 6:148825539-148825561 CCTGAGTCTCAAGCACCTCCTGG + Intronic
1017328421 6:153167456-153167478 GCTGACTCACAGAAACATCTGGG + Intergenic
1017620207 6:156288810-156288832 ACTGACTCTGAGACACGTCCTGG - Intergenic
1019131965 6:169883444-169883466 GCTGGCTCTCAGGCAGGTTCGGG + Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1020662359 7:10996851-10996873 GCACACTCTCAGGAACATACAGG + Intronic
1028155898 7:87429125-87429147 GCTGACTCTCAGGCTCACAGTGG + Intronic
1028330626 7:89586747-89586769 GCTGTGTCTCAGGTAAATCCTGG - Intergenic
1033937597 7:146606712-146606734 ACTGAATCTCAGGCACCTGCTGG - Intronic
1035632164 8:1116306-1116328 GCTGTGTCTCAGCCACAGCCTGG + Intergenic
1038713602 8:29972051-29972073 GCTGACTCACAGGCTCATGAAGG + Intergenic
1039685904 8:39801669-39801691 GCTCAGGCTCAGGGACATCCGGG + Intronic
1043563642 8:81523659-81523681 GATGACTCTCAGGAACACCTGGG - Intergenic
1045091869 8:98754338-98754360 GGTGGCTCTCATGCACAGCCAGG - Intronic
1049488745 8:142879905-142879927 TCGGTCTCTCAGGCAGATCCAGG - Intronic
1049738350 8:144221971-144221993 GGTGACTCGGAGGCACAGCCAGG - Intronic
1050882655 9:10722359-10722381 GATGACTCTCAGGAACATCTGGG - Intergenic
1051528940 9:18078485-18078507 ACTAACTTTCAGGCTCATCCAGG + Intergenic
1052378266 9:27741906-27741928 GCTGGCTCTAAGGCACATTTAGG + Intergenic
1055600226 9:77908826-77908848 GCAGAATCTCAGGCCCACCCTGG + Intronic
1057703951 9:97384726-97384748 CCTCTCTGTCAGGCACATCCTGG - Intergenic
1059407681 9:114111970-114111992 GGTGACTCTAATGCACAGCCAGG + Intergenic
1060227937 9:121807618-121807640 GCTGACTCTGCCGCACCTCCTGG - Intergenic
1060252570 9:121997868-121997890 GCTGACACCCAGGCAGACCCAGG - Intronic
1061206274 9:129165452-129165474 GTTGACTGTCAGGCACAGCCAGG + Intergenic
1062103984 9:134742718-134742740 GCTGACTCTTTTGCGCATCCGGG + Intronic
1062536030 9:137021517-137021539 TCTGACTCTCAGGCACAGTGAGG + Exonic
1189156248 X:38759856-38759878 GTTGACTCTCCGGCATTTCCAGG + Intergenic
1189329203 X:40132843-40132865 GCTGACTCTGACGCACAGCCAGG - Intronic
1190679003 X:52808457-52808479 GCACACTCTCAGACACACCCAGG - Intergenic
1191677777 X:63809777-63809799 GCTGATTCTCATGTACAGCCAGG - Intergenic
1193262287 X:79422808-79422830 GCTGTCTCACAGACACACCCAGG + Intergenic
1197089935 X:122524047-122524069 CATGACTCTCAGGCACATTACGG + Intergenic
1198374931 X:136029403-136029425 GCTGACTCTCGGGGAGAGCCTGG + Intronic
1199593795 X:149491366-149491388 GCTGACTCTCATTCCCAACCTGG + Intronic