ID: 1118181069

View in Genome Browser
Species Human (GRCh38)
Location 14:63493935-63493957
Sequence CTGTTTAAACTGTAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118181067_1118181069 27 Left 1118181067 14:63493885-63493907 CCTAAAGTCGGGTTACTTGTTCT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1118181069 14:63493935-63493957 CTGTTTAAACTGTAGGAAGAAGG 0: 1
1: 0
2: 1
3: 16
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118181069 Original CRISPR CTGTTTAAACTGTAGGAAGA AGG Intronic
902488289 1:16762436-16762458 CTCTTCAAACCGTAGCAAGAGGG + Intronic
909983927 1:82137029-82137051 ATCTTTAAAATATAGGAAGATGG + Intergenic
910086553 1:83410141-83410163 CTCTTTAAACTGTAAGCTGATGG - Intergenic
910207835 1:84765441-84765463 CTGCTGAGACTGTAGGGAGATGG - Intergenic
911331961 1:96535030-96535052 CTGTTTGAACTGCTTGAAGATGG + Intergenic
911356882 1:96833549-96833571 TTCTTAAAAGTGTAGGAAGAGGG - Intergenic
911780388 1:101869114-101869136 CTGTTGGACCTGTAAGAAGATGG + Intronic
911849691 1:102802613-102802635 CTGTTTAAAATCTATAAAGAGGG + Intergenic
912646062 1:111393242-111393264 CTGTATAAATGGTAGGCAGAAGG - Intergenic
914884136 1:151571307-151571329 CTGTTTCAACTTTTGGAAAAAGG + Intronic
915014580 1:152720931-152720953 CTGTTGAAACTATAGGTTGAAGG + Intergenic
919061386 1:192638300-192638322 CGGCTTAAACTGAAGGAAAAAGG - Intronic
921067146 1:211631157-211631179 CTGTTGAAAGAGTGGGAAGAGGG + Intergenic
923532153 1:234820077-234820099 CTCTTCAAACCGTAGCAAGAGGG - Intergenic
923689658 1:236179704-236179726 CACTTGAAATTGTAGGAAGAAGG + Intronic
923899044 1:238305419-238305441 CTACTGGAACTGTAGGAAGAAGG + Intergenic
1063576539 10:7266645-7266667 CTGTTGAAACTGAAGTCAGATGG - Intronic
1063629880 10:7723389-7723411 GTGTTTAGAAGGTAGGAAGATGG - Intronic
1064259828 10:13776409-13776431 CTGTTAAAAATGGATGAAGACGG - Intronic
1064743672 10:18458400-18458422 TTGTATAAACTGTATGAGGATGG + Intronic
1064809708 10:19181959-19181981 CTATTTTAACTCTAGGAAGTTGG + Intronic
1065022857 10:21515383-21515405 CAGTTTTACCTGTAGGACGAGGG + Exonic
1065330348 10:24590393-24590415 CAGCTGGAACTGTAGGAAGAAGG - Intronic
1065819042 10:29508382-29508404 TGTTTTAACCTGTAGGAAGAAGG - Intronic
1068013865 10:51489259-51489281 ATGATTAATCTGTAGGCAGACGG + Intronic
1069650325 10:70042579-70042601 CTGTATAAAAGGTAGGAACAGGG + Intergenic
1070004949 10:72414847-72414869 CTGATTAAAAGGCAGGAAGAGGG - Intronic
1070270298 10:74947661-74947683 AAGGGTAAACTGTAGGAAGAAGG - Intronic
1071722900 10:88165153-88165175 CTTTGTAAACTGTAAGAAGTGGG + Intergenic
1072022004 10:91411010-91411032 CTGTTTAATCTGAAGGGGGAAGG - Intronic
1073016017 10:100399780-100399802 TTGTTTGAAATCTAGGAAGAAGG - Intergenic
1074364572 10:112847584-112847606 CTGCTCAAACTGTAGAAACAGGG - Intergenic
1075159835 10:120013366-120013388 CAGGTTAAACTGAAGGAAGGTGG + Intergenic
1075842518 10:125517241-125517263 CTGTGGAAAGTGTTGGAAGATGG + Intergenic
1076055919 10:127372820-127372842 CACTCTAAACTGAAGGAAGATGG - Intronic
1079559394 11:21803704-21803726 CTTGTGAAGCTGTAGGAAGAGGG - Intergenic
1080393509 11:31869801-31869823 CTCTTTATACTGGAGGAAGGGGG - Intronic
1080931619 11:36817337-36817359 CTGCTTAAACTGTAGCGAGTAGG - Intergenic
1082825034 11:57571397-57571419 TTCTTTAAGCTCTAGGAAGATGG - Intergenic
1083690425 11:64404943-64404965 CTGGCTGAACTGGAGGAAGAGGG - Intergenic
1083978379 11:66143064-66143086 CTTTTTAAACTGCAGTAAGGTGG + Intronic
1084057693 11:66647170-66647192 CTGTAGAAACTGGAGCAAGAAGG - Intronic
1086171388 11:83840424-83840446 CTGGTTAAAATCTAGGAAGAGGG - Intronic
1086223855 11:84483651-84483673 TTTTTAAATCTGTAGGAAGAGGG + Intronic
1086573367 11:88309918-88309940 CTGTAGAAACTGTAGGGAGTAGG - Intronic
1087528752 11:99352554-99352576 TTGTTTCAACTTTAGGAATAGGG - Intronic
1087549220 11:99626120-99626142 CTGTAGAAATTGCAGGAAGAAGG + Intronic
1089133190 11:116228432-116228454 CTCTTTTAGCTATAGGAAGATGG + Intergenic
1089759752 11:120714771-120714793 CTTTTTGAAATGTAGGGAGAGGG + Intronic
1091262719 11:134246599-134246621 CTGTGTAACCTATAGGGAGAGGG - Exonic
1091923428 12:4323777-4323799 CTGTTTTATGTGTAGGAAGATGG + Intronic
1093941424 12:25059245-25059267 CTGTCTTAACTGTATTAAGAAGG - Intronic
1094431923 12:30379518-30379540 ATGTATAAACTGTCAGAAGAAGG - Intergenic
1099343881 12:81473491-81473513 CTGATGAAGCTGTAGGAAGATGG - Intronic
1099986318 12:89669177-89669199 CTGATTAAACTGTAAGCTGAGGG + Intronic
1100182713 12:92102864-92102886 CAGTTCAAACTGGGGGAAGAGGG + Intronic
1100659560 12:96682089-96682111 CAATTTAAAATGTAGAAAGAAGG - Intronic
1101223668 12:102666410-102666432 TTGTTTTAACTGTGGGAAGCAGG - Intergenic
1102092589 12:110204549-110204571 CTGTTTAAAGCTCAGGAAGAAGG - Intronic
1103460879 12:121104094-121104116 CTTTTTATATTGTAGGAAGAGGG - Intergenic
1104601325 12:130155740-130155762 CTGGTTAAATTCAAGGAAGAAGG + Intergenic
1105649325 13:22357441-22357463 GTCTTTAAACTGTAGGATGTGGG + Intergenic
1105959655 13:25319398-25319420 CTTATTAAATTGTAGGCAGATGG + Intronic
1107923032 13:45229464-45229486 CTCTTTAAGCTGTTGGGAGATGG + Intronic
1109551133 13:63902227-63902249 CTGATACAACAGTAGGAAGATGG + Intergenic
1110006876 13:70283101-70283123 ATGTTTCAACTATAGTAAGAAGG - Intergenic
1113355857 13:109579359-109579381 CTGTTTAAACAGTATGGAAATGG + Intergenic
1113363817 13:109657039-109657061 TTGTTTAATCTGATGGAAGAAGG + Intergenic
1116153619 14:41174496-41174518 CTGTTTAAGGTGCAAGAAGAGGG - Intergenic
1117685830 14:58252177-58252199 CTTTCTAAACTTTATGAAGAAGG + Exonic
1118181069 14:63493935-63493957 CTGTTTAAACTGTAGGAAGAAGG + Intronic
1119008265 14:70955274-70955296 CAATTTAAACTGTATGAAGCTGG + Intronic
1122565504 14:102652186-102652208 CTGTTTAATCTCTTTGAAGAAGG + Intronic
1122852828 14:104546175-104546197 CTGCTTCAGCTGCAGGAAGACGG - Intronic
1123126365 14:105948954-105948976 CTGTTAACACTGTGGGGAGAAGG + Intergenic
1123468625 15:20534065-20534087 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1123649489 15:22466997-22467019 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1123728943 15:23129276-23129298 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1123747107 15:23326741-23326763 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1124279376 15:28350057-28350079 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1124303322 15:28561551-28561573 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1124515010 15:30360508-30360530 TTGTTTGCACTGGAGGAAGATGG - Intergenic
1124532221 15:30517991-30518013 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1124727912 15:32170219-32170241 TTGTTTGCACTGGAGGAAGATGG + Intronic
1126922972 15:53548320-53548342 CTGTTTATTCTGTAGGAGCATGG - Intronic
1127076659 15:55332883-55332905 CTGTATAAACTGTATGATCATGG - Intronic
1129030001 15:72611167-72611189 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1129038220 15:72663915-72663937 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129107987 15:73322415-73322437 CAGTTAAACCTGAAGGAAGAAGG + Exonic
1129211670 15:74073316-74073338 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1129290582 15:74563958-74563980 CTGATTAAGCTGTAGAAAGCGGG - Intronic
1129398733 15:75267768-75267790 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129402341 15:75292044-75292066 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129728792 15:77917591-77917613 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1129839726 15:78736280-78736302 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1130397198 15:83512889-83512911 CTTTTTAAAATGTGGGAAGCAGG - Intronic
1131305885 15:91242905-91242927 TTTTTGAAACTGTAGGAATAGGG + Intronic
1131435802 15:92420625-92420647 ATGTTTAAATTGAAGGCAGAAGG + Intronic
1133143943 16:3769775-3769797 CTGTGTGAACGGTAGGAACACGG + Intronic
1133187782 16:4112803-4112825 CTGTTTAAAAAGGAGGAAGTGGG + Intronic
1133590676 16:7239950-7239972 CTGTTGAAACTATAAGATGATGG + Intronic
1135917920 16:26622749-26622771 TTGTTTCAATTTTAGGAAGAAGG + Intergenic
1137902691 16:52286204-52286226 CTGTTTAAACTGTCAAAAAATGG + Intergenic
1144168458 17:12635128-12635150 TTGATTTAACTGTAGGAGGATGG - Intergenic
1147280360 17:39355376-39355398 CTATTTAAAATATATGAAGAAGG - Intronic
1148582861 17:48755397-48755419 CCGTGGAAACTGTAGGTAGATGG - Intergenic
1150175592 17:63051483-63051505 CTGTTGAAACTGTATGTTGAGGG + Intronic
1150496121 17:65609083-65609105 CTGTGTAAACTATAGAAAGTGGG + Intronic
1153413180 18:4816655-4816677 ATCTTTAAACTGAAGGAAAATGG + Intergenic
1154064544 18:11094913-11094935 CTTTTGGAGCTGTAGGAAGAGGG - Intronic
1156821071 18:41373650-41373672 TTGGTTAAACAATAGGAAGAGGG + Intergenic
1157857926 18:51118315-51118337 CCCTTCAAACTGTAGGGAGAGGG - Intergenic
1159890272 18:73946405-73946427 TTGTTTACAATGGAGGAAGAAGG + Intergenic
1162449795 19:10747910-10747932 CTGTTAATGCTGCAGGAAGAAGG + Intronic
1164427030 19:28150636-28150658 GTCTTTAAACTGTGGAAAGACGG + Intergenic
1165570911 19:36774231-36774253 CTGTTTAAACCATGGGTAGATGG + Intronic
1202702908 1_KI270713v1_random:1804-1826 CTCTTCAAACCGTAGCAAGAGGG - Intergenic
925367622 2:3321788-3321810 CTTTTTAAGCTGTAGAAAGAAGG - Intronic
926228752 2:10986918-10986940 CTGTTTTCCATGTAGGAAGAAGG + Intergenic
926626105 2:15091281-15091303 CAGTTCAAACTGTATGAAGTGGG - Intergenic
929562771 2:42966225-42966247 CTGTTCAACCTGTAGGCAGGGGG + Intergenic
930296300 2:49558672-49558694 CAGTTCAAACTGAAGGAAAAAGG - Intergenic
930395307 2:50815850-50815872 TTATTTAACTTGTAGGAAGATGG - Intronic
930708336 2:54526056-54526078 GAGTTTAAACTTTAGAAAGAAGG + Intronic
933176444 2:79179132-79179154 TTTTTGAAACTGGAGGAAGAAGG + Intergenic
935091856 2:99902155-99902177 CTGCTTAAACTGTAGGCTCATGG + Intronic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936512909 2:113162898-113162920 CTATTTAAACTATAGCATGATGG - Intronic
937217399 2:120321365-120321387 ATGTTTAAACTCGAAGAAGAAGG - Intergenic
937249824 2:120516311-120516333 CTGTTTATACAGTGGGAATAGGG - Intergenic
937862878 2:126724852-126724874 GTGTTTAACCAGAAGGAAGAGGG - Intergenic
938102198 2:128504791-128504813 CTGTTGATTCTGTTGGAAGATGG + Intergenic
938806226 2:134809229-134809251 CCCTTTAAGCTGTAGGGAGAGGG - Intergenic
940181352 2:150937036-150937058 CTGTTTAACATGTATGAACATGG - Intergenic
940764612 2:157776547-157776569 CAGTTTAAACAGTAGGTAAATGG + Intronic
940807427 2:158203975-158203997 CTGTTTAAACTACAGGAATAAGG - Intronic
942337812 2:174909275-174909297 TTGTTTTAAGTGAAGGAAGAAGG - Intronic
942885450 2:180918159-180918181 TTTTCTAAACTGTAGGATGAGGG - Intergenic
943211933 2:184977868-184977890 CTGGTTAAACTGTACAAAGAGGG - Intergenic
944121639 2:196246842-196246864 CTGTTTATACTCTAGGTAAAGGG + Intronic
945633379 2:212313948-212313970 TTGTTTAAATTGTGGGATGAAGG - Intronic
946352262 2:219162856-219162878 CTGTTACAAATGGAGGAAGAGGG - Intronic
947356794 2:229304628-229304650 CTGTGTACACTGTAGTGAGAAGG - Intergenic
948110066 2:235447843-235447865 AAGATTAAACTGTTGGAAGATGG + Intergenic
1169985414 20:11437933-11437955 CTTTGTAAAATGAAGGAAGAAGG + Intergenic
1170285532 20:14704333-14704355 CTATTTACACGGTAGGAAAAGGG - Intronic
1172364747 20:34340332-34340354 CTGTTTAAACTGAAGTGAGTTGG + Intergenic
1174158615 20:48534298-48534320 ATTTTTAAACTGAAAGAAGATGG - Intergenic
1174947703 20:55006730-55006752 CTGTTTTAATTGTAGGGACAAGG + Intergenic
1176887062 21:14269710-14269732 TTTTTTAAAATGTGGGAAGAGGG + Intergenic
1178079746 21:29051383-29051405 CAGTTTAAACTATGAGAAGATGG + Intronic
1178317291 21:31577282-31577304 TTCTTTTAACTGTAAGAAGAGGG + Intergenic
1178324177 21:31630000-31630022 CTGTTAAAACTGGACAAAGATGG - Intergenic
1180687681 22:17682538-17682560 CTTTTTAAAAAGTATGAAGATGG - Intronic
949337762 3:2994689-2994711 CTGTTTTAACTGTAGGACATTGG + Intronic
950980281 3:17296945-17296967 CTGTTTAAAGTGTATTAAGTGGG - Intronic
955423657 3:58764845-58764867 CTCTTGAAACTGGAGGGAGAGGG + Intronic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
955806708 3:62743917-62743939 CTGTCTAGACTCTAGGAAGGTGG - Intronic
957017402 3:75084050-75084072 CTTTTCAAACTCTATGAAGATGG + Intergenic
957513140 3:81215772-81215794 CTGGTGAAACTGTGGCAAGAAGG - Intergenic
958799739 3:98742021-98742043 CTGTGTAAAATATATGAAGAAGG - Intronic
960242824 3:115365749-115365771 CTGTTTCAACAGTAGGAAAAAGG + Intergenic
961135262 3:124504282-124504304 TTTTTTAAACAGAAGGAAGAGGG - Intronic
963237120 3:142966650-142966672 GTGTTGAAACTGTAGCAAAAGGG + Intronic
964137348 3:153359655-153359677 CTCTTTAAACTTTTGGAAGGGGG + Intergenic
964284655 3:155104639-155104661 ATGTTTAAACAGAAGGAACATGG + Intronic
965433868 3:168622341-168622363 CAGTTTAAATTGTAGGATGATGG + Intergenic
966119588 3:176507241-176507263 ATTTTTAAACTGTACTAAGATGG - Intergenic
967014440 3:185468880-185468902 TAGTTTTAACTGTAGGCAGAAGG - Intronic
967457894 3:189710918-189710940 CTGTTAAAACTCTAGGAACTTGG - Intronic
972433363 4:39006536-39006558 CTTTTTAACCTTAAGGAAGAAGG - Intronic
975185956 4:71402931-71402953 CTGTTTAAGCTTTAAGAATATGG - Intronic
976176613 4:82360513-82360535 CTTTTTAAAGGGTAGAAAGAAGG - Intronic
977207075 4:94175371-94175393 GTGTTTAAAGAGTAGGAAAAGGG - Intergenic
981343367 4:143647868-143647890 CTGATTAAACGGTGAGAAGAAGG + Intronic
982322000 4:154086671-154086693 CTTTTTAAAATGTAGAAACAGGG - Intergenic
983711672 4:170724529-170724551 ATGCTTAAATAGTAGGAAGAAGG - Intergenic
987651825 5:20751085-20751107 ATGTTCTAACTTTAGGAAGAAGG + Intergenic
989049466 5:37305202-37305224 CTGTTTAATCTGAAAGAAAATGG + Exonic
989149699 5:38286759-38286781 CTGTGTAAACTATAGCAAGATGG - Intronic
989964414 5:50451397-50451419 CTCTTTAAGCTGTAGGGAGTGGG - Intergenic
992868530 5:80982429-80982451 ATGTTTAACCTGTAGGAAGAAGG + Intronic
992913819 5:81426749-81426771 CTGTCTTAACAGTTGGAAGAGGG - Intronic
993248267 5:85480397-85480419 CTGTTAAAAGTGGAGGAAGAAGG - Intergenic
993319657 5:86457306-86457328 CTATTTTAACTGGAGGATGATGG - Intergenic
994525945 5:100904487-100904509 CTGTTCAACCTGAAGGAACACGG - Intergenic
995314818 5:110757354-110757376 CAGTTTTAAGTGTAGGAAGGAGG - Intronic
996038489 5:118784718-118784740 ATGTTTTGACTGGAGGAAGATGG - Intergenic
996466814 5:123812200-123812222 ATGTTTAAACTGCAGAAAAATGG - Intergenic
998216386 5:140241165-140241187 CTGATTAAACTGGAGGAAAAAGG + Intronic
999796129 5:154991358-154991380 AAGTGTAAACTCTAGGAAGAGGG + Intergenic
1001358488 5:171056900-171056922 CTGAATAAACTGTAGGAAAAAGG - Intronic
1003518845 6:6840486-6840508 CTGTTTTCATTTTAGGAAGAGGG - Intergenic
1003685805 6:8300833-8300855 CTTTGTAAACTGTAGAAAGCCGG + Intergenic
1004142475 6:13031895-13031917 CTGTTTAACCTGTATTAAGATGG + Intronic
1005585814 6:27275519-27275541 CTCTTTCAACTCTAGGAACACGG - Intergenic
1005750529 6:28877886-28877908 CTATTTGAACTGGAGAAAGAAGG + Intergenic
1007993911 6:46286202-46286224 CTGTTCAAACTGTTCGAATAAGG + Intronic
1008828294 6:55726547-55726569 CTGTGAAAAATGGAGGAAGAGGG - Intergenic
1012662220 6:101914821-101914843 CAGTTTACAATTTAGGAAGATGG - Intronic
1012787634 6:103652165-103652187 CTGTTAAAAATGTAGGAAGCTGG - Intergenic
1012913146 6:105138966-105138988 CTGTTTAAACTGGTAGGAGAGGG - Intergenic
1014144702 6:117984024-117984046 CTGTTTAAACTGTTGTTGGAGGG - Intronic
1016407212 6:143743190-143743212 CAGTCTAAATTCTAGGAAGAAGG + Intronic
1021275134 7:18640881-18640903 CTCATTAAGCTGTAGGATGATGG - Intronic
1021380085 7:19955894-19955916 CTAGTGAAACTGTGGGAAGAAGG + Intergenic
1021398966 7:20187491-20187513 GAGTTTAAGCTGTGGGAAGAGGG - Intronic
1024628184 7:51226280-51226302 CTGTTTATGCTGCAGGCAGAAGG + Intronic
1029035865 7:97521006-97521028 TCGTTAAAACTGAAGGAAGATGG - Intergenic
1030640157 7:111995834-111995856 GTGTTTAAGCTCTAGAAAGAAGG - Intronic
1031876155 7:127143164-127143186 CTATTAGAACTGTAGGAAAAAGG - Intronic
1031956194 7:127944928-127944950 CAGTGTAATCTCTAGGAAGATGG - Intronic
1032242170 7:130171470-130171492 ATGTTTACACTGTAAGAACAAGG + Intronic
1032598950 7:133272404-133272426 CTGTTTCATCTGTAAAAAGAGGG + Intronic
1033238067 7:139654137-139654159 CTGTTAAACCTATAGGAACAGGG - Intronic
1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG + Intergenic
1035843675 8:2840248-2840270 ATTTTTAAACTGTAGGACTATGG - Intergenic
1037668677 8:20996160-20996182 CTCTGTAAACTGTAAGGAGATGG + Intergenic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1040926126 8:52685305-52685327 CTGTTTAAAAAGTAGGATAATGG - Intronic
1042077474 8:65012326-65012348 TTATTTAAACTGTAGGAATCAGG - Intergenic
1042466110 8:69131651-69131673 CTGATTAAACTGGATGATGAGGG + Intergenic
1043138827 8:76562331-76562353 CTTTGTAAACTGTAAGAAAATGG + Intergenic
1044931693 8:97258017-97258039 ATGTGTAAACTGTAGGGGGAGGG - Intergenic
1047994134 8:130317405-130317427 TTGTTGAAACTGTAGGAACAGGG + Intronic
1052054622 9:23890370-23890392 CTGTTGAAGGTGTAGGGAGAGGG - Intergenic
1055961507 9:81824867-81824889 TTTTTTAAACTGTCAGAAGAGGG + Intergenic
1059774694 9:117463441-117463463 CACTTTCAATTGTAGGAAGATGG - Intergenic
1061062907 9:128259571-128259593 CGGTTTAAATGGTGGGAAGAAGG - Intronic
1189862163 X:45284020-45284042 CTTTAAAAACTGTATGAAGAGGG + Intergenic
1190051332 X:47151726-47151748 CAGTTGAGACAGTAGGAAGAAGG + Intronic
1191013200 X:55782830-55782852 CTGATTCAGCTGTATGAAGAAGG + Intergenic
1195334284 X:103833964-103833986 ATTTTTAAACTGTTGGAAAATGG - Intergenic
1195994764 X:110720736-110720758 GTGTTTAAACTGAAGCAGGAAGG - Intronic
1196119840 X:112038014-112038036 GTTTTTAAACTCTTGGAAGAAGG - Intronic
1199602435 X:149550119-149550141 CTGTTTATACTTTTAGAAGAGGG - Intronic
1199647953 X:149929356-149929378 CTGTTTATACTTTTAGAAGAGGG + Intergenic
1201590036 Y:15604546-15604568 CTGTTTCAACTGTGGTAAAAAGG - Intergenic
1201612811 Y:15861683-15861705 CTGCTTCAACAATAGGAAGAGGG + Intergenic