ID: 1118182009

View in Genome Browser
Species Human (GRCh38)
Location 14:63503168-63503190
Sequence CTGTATGTACAGAGGGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118182006_1118182009 -5 Left 1118182006 14:63503150-63503172 CCATTTTTTTTTTAACTACTGTA 0: 1
1: 1
2: 13
3: 167
4: 1488
Right 1118182009 14:63503168-63503190 CTGTATGTACAGAGGGATTTTGG 0: 1
1: 0
2: 0
3: 18
4: 181
1118182005_1118182009 13 Left 1118182005 14:63503132-63503154 CCAAACAGGGAAAGTTAGCCATT 0: 1
1: 0
2: 1
3: 12
4: 100
Right 1118182009 14:63503168-63503190 CTGTATGTACAGAGGGATTTTGG 0: 1
1: 0
2: 0
3: 18
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118182009 Original CRISPR CTGTATGTACAGAGGGATTT TGG Intronic
900766626 1:4510166-4510188 CTGAAAATACAGAGGAATTTAGG + Intergenic
900829785 1:4957797-4957819 CTGTATTTCCAGAGAGATCTGGG - Intergenic
901037279 1:6343900-6343922 CTGGGTGTACAGAGGGGTGTGGG + Intronic
904703343 1:32372251-32372273 CTGAAGGCACAGAGGGATGTAGG - Intronic
904877797 1:33669954-33669976 CAGTATTTCCAGAGGGATCTTGG + Intronic
906078716 1:43069830-43069852 CTGAATGTGCAGAGGAATGTAGG + Intergenic
909164103 1:72195726-72195748 CTGAAAGTACAGACAGATTTAGG + Intronic
909640686 1:77868596-77868618 ATTTAAGTACAGAGGGAATTTGG - Intronic
913391289 1:118315282-118315304 CTCTTTGTACTGAAGGATTTTGG + Intergenic
913616362 1:120564094-120564116 CTGTAGGTAAAGAGAGATGTTGG + Intergenic
914573915 1:148946810-148946832 CTGTAGGTAAAGAGAGATGTTGG - Intronic
914576794 1:148979075-148979097 CTGTAGCTACAGAGAAATTTGGG - Intronic
916505529 1:165425097-165425119 ATGTCTGTACAGAGGGATTGGGG - Intronic
917015448 1:170526511-170526533 CTTTATGTACATGGGGCTTTTGG - Intergenic
920093344 1:203469996-203470018 CAATTTGCACAGAGGGATTTAGG + Intergenic
920224938 1:204431630-204431652 CTATCTGCACAGAGGGATGTCGG - Intronic
921583143 1:216918297-216918319 CTGTATGTACACAGAGAGTTTGG + Intronic
924464806 1:244290381-244290403 ATGGATTTACAGAGGGATTCTGG - Intergenic
924881504 1:248166089-248166111 CTGTATTTACCGAGGGATCCTGG - Intergenic
924884201 1:248194922-248194944 CTGTATTTACCGAGGGATACCGG - Intergenic
1063541715 10:6940766-6940788 GTGTATTTACAGAGGTAATTAGG - Intergenic
1064716006 10:18177290-18177312 CTTTATCCACAGAGGGTTTTGGG + Intronic
1065403378 10:25332572-25332594 CTGTATTTGCAGAGGCATTTGGG + Intronic
1065951595 10:30657235-30657257 TTGTATGTTCAGAGAGAGTTTGG + Intergenic
1066504508 10:36027407-36027429 CTGAAGGTAGAGAAGGATTTAGG + Intergenic
1067517408 10:46963580-46963602 ATGTGTGTACAGAGGGATGAGGG + Intronic
1067644840 10:48088249-48088271 ATGTCTGTACAGAGGGATGAGGG - Intergenic
1070348723 10:75571269-75571291 TTGGATGTATAGAGGGAATTAGG + Intronic
1071506420 10:86234406-86234428 CTGGATGCACACAGGGATTCTGG - Intronic
1072552940 10:96493182-96493204 CTGTAGGCACAGAGAGATTTAGG + Intronic
1073346112 10:102784202-102784224 TTGTATGTACAAAGTCATTTGGG - Intronic
1074335529 10:112570649-112570671 ATGTATGCACAGAGGTATTCTGG - Intronic
1076292756 10:129360378-129360400 CTGGAGGAACAGACGGATTTAGG + Intergenic
1076316741 10:129547318-129547340 GTGTATGGACAGAGGGACTAGGG - Intronic
1077222743 11:1424718-1424740 CTGTTTGGACAGAGGGAGTCGGG + Intronic
1078109599 11:8381988-8382010 CTGTGGTTACAGAGGGATATGGG - Intergenic
1084163583 11:67364670-67364692 TTGGATGTATAGAGTGATTTGGG + Exonic
1088722211 11:112604035-112604057 TTGTATGTAGACAGGGATGTGGG + Intergenic
1089367093 11:117927501-117927523 CTGGATCTTCAGAGGGATCTTGG - Intronic
1092138001 12:6163058-6163080 CTGTCTGTACGGGGGGATGTTGG - Intergenic
1093954757 12:25202893-25202915 GTGTATATACATACGGATTTAGG - Intronic
1095131959 12:38553377-38553399 TTGTATTTACAGTGGGAGTTTGG + Intergenic
1097733159 12:63151780-63151802 CTGTATTCACAGCGGGGTTTGGG + Intergenic
1098778195 12:74650119-74650141 CTCTATGTGAAGAGAGATTTGGG + Intergenic
1099803712 12:87490177-87490199 CTGTATCTAGAGAGTGATTTTGG - Intergenic
1103642075 12:122359525-122359547 CTGTCTGAACACAGGGGTTTGGG + Intronic
1104242984 12:127008934-127008956 CTGTATTTACGGAGTGATTGAGG + Intergenic
1104346438 12:128003837-128003859 CTCTATTTACAGTGGGTTTTGGG + Intergenic
1107424006 13:40275126-40275148 CTGTAGGGACAGAGGGTTTGGGG - Intergenic
1107843739 13:44488859-44488881 CTGAATCTACAGATGAATTTGGG - Intronic
1108977252 13:56462888-56462910 CTGTAGGTCCAGAGGGAGTCAGG + Intergenic
1110700313 13:78539743-78539765 CTGGATGTACAGAACCATTTTGG - Intergenic
1111188103 13:84770190-84770212 CTGTATCTCCACAGGAATTTTGG + Intergenic
1111787842 13:92813818-92813840 CTGAATGTACAGATTAATTTAGG - Intronic
1112470158 13:99681129-99681151 CTGAATGTAAAGAGTGATTCTGG + Intronic
1113347141 13:109489939-109489961 CTGTTTTTATAGAGGGATTCAGG + Intergenic
1113522825 13:110952876-110952898 CTGTGTGTACAGATGGCCTTAGG - Intergenic
1113702549 13:112397961-112397983 CTGTGTGTACAGATGGCCTTAGG + Intronic
1117391419 14:55266360-55266382 CTTTATATTTAGAGGGATTTTGG - Intergenic
1118182009 14:63503168-63503190 CTGTATGTACAGAGGGATTTTGG + Intronic
1118422061 14:65617594-65617616 CTGTATGTAAAGGAGAATTTTGG + Intronic
1119717816 14:76871162-76871184 CTGCATGTGCAGAGGGGTCTTGG - Intergenic
1119750034 14:77070668-77070690 CTGTATGAACAGAAGGGTTGGGG - Intergenic
1120924349 14:89782876-89782898 CTGCATGTGCAAAGGGATCTAGG - Intergenic
1123799937 15:23809070-23809092 CTTTATGTACAGAGTGATGTTGG + Intergenic
1130135449 15:81177960-81177982 CTGTATGTTCCTAGGGACTTTGG - Intronic
1132374887 15:101322519-101322541 CTGTCTGTAAAGAAGGATTCAGG - Exonic
1138752245 16:59437810-59437832 CTTTATGTTAATAGGGATTTGGG + Intergenic
1139642342 16:68301309-68301331 CTGGATGTGCAGAAGGAGTTCGG - Exonic
1141517031 16:84552365-84552387 CTGTCTGCACAGAGGTATTTGGG - Intronic
1146985532 17:37213138-37213160 GTGTGTGTAAAGATGGATTTTGG - Intronic
1147214006 17:38888662-38888684 CTCTATGAAGGGAGGGATTTTGG - Intronic
1148255261 17:46125527-46125549 CTATATGGACAGATGTATTTGGG - Intronic
1149377896 17:56064305-56064327 CTGTTAGTACAGAGGAATATGGG - Intergenic
1150991310 17:70262981-70263003 CTGAATGTACAGAGTTATTGTGG + Intergenic
1151043203 17:70888258-70888280 TGGTATGTACTGAGGGATTGGGG - Intergenic
1152683570 17:81682915-81682937 CTGTGTGTAGAAAGGGGTTTGGG - Intronic
1153116607 18:1664613-1664635 CTGTCTGTAAAGAGGGGTCTAGG - Intergenic
1164304435 19:23992287-23992309 CTGAATGTACAGAGCCACTTTGG - Intergenic
1164561870 19:29297999-29298021 CTGGATGCACAGAGGCATTGAGG + Intergenic
1167027414 19:46931020-46931042 CAGTACCTACAGAGGGAATTAGG + Intronic
1167937868 19:52922495-52922517 CTGGATGTACAGAGAGATGAAGG - Intergenic
1167999453 19:53432848-53432870 CTGGATGTACAGAGAGATGAAGG + Intronic
925329055 2:3044076-3044098 CTGTGTTTGGAGAGGGATTTAGG + Intergenic
926462232 2:13145252-13145274 CTGTTTTTAAAGAGGGACTTGGG + Intergenic
926514544 2:13825423-13825445 ATTTTTGTACAGATGGATTTGGG - Intergenic
926594700 2:14777406-14777428 TTTTATGTAAAGAGAGATTTTGG + Intergenic
927444619 2:23148152-23148174 CTGTATGTGCAGAGAGAGTCAGG - Intergenic
928477731 2:31647704-31647726 CTGTATGTACAGAGCACTTCTGG - Intergenic
929077889 2:38093442-38093464 CTTTATATACAAAGGGATTAAGG + Intronic
929334802 2:40728842-40728864 CAGTAAGGACAGAGGGATATGGG - Intergenic
930351382 2:50259958-50259980 CTGCATGTACAGATGAAATTGGG + Intronic
930956119 2:57204872-57204894 CTCTTTATACAGAGGGACTTTGG - Intergenic
931257265 2:60584543-60584565 CTGGAGTTACAGAGGGAGTTGGG - Intergenic
934658908 2:96132758-96132780 CTGTATGTCCGGAGGGATCTGGG - Intronic
937760877 2:125602367-125602389 CTATATATGCAGAGAGATTTGGG - Intergenic
938610535 2:132943515-132943537 CTGTGTGTAAAGAGGGGTTTGGG - Intronic
940039920 2:149349328-149349350 CTGTAGGTACAGAGAGAAGTAGG + Intronic
940505662 2:154549964-154549986 CTGTACTTTCAGTGGGATTTGGG - Intergenic
940763607 2:157765483-157765505 CTGTATCTCGACAGGGATTTGGG + Intronic
941034164 2:160548658-160548680 TTGAATCTACAGAGGAATTTTGG + Intergenic
941296001 2:163738300-163738322 CTGTGTGTCCAGAGGACTTTTGG - Intergenic
941577876 2:167257795-167257817 CTGTAAGTTCATAGGGAATTGGG - Intronic
942338570 2:174918179-174918201 ATGTATGTACAGTGGGATGTGGG - Intronic
943066194 2:183089299-183089321 CTGCCTGTCCAGAGGTATTTTGG - Intronic
943127923 2:183819175-183819197 CTGGATTCACAGAGTGATTTAGG + Intergenic
948586760 2:239024635-239024657 CTGTTTGTTCACAGGGATGTGGG - Intergenic
1169560925 20:6799924-6799946 CTGGATTTACTGAGGGATGTGGG + Intergenic
1169569161 20:6887954-6887976 CTGGATTTACAGCTGGATTTAGG + Intergenic
1170036989 20:12000043-12000065 TTGTATGTACAGCAGGATTGGGG + Intergenic
1173417345 20:42868817-42868839 CTGTATGAAAAAAGGGATCTTGG + Intronic
1175787928 20:61723761-61723783 GTGTGTTTACAGAGGGATCTGGG + Intronic
1176663925 21:9666625-9666647 CTGTTTCTGCAGAGGGATTTGGG + Intergenic
1178668576 21:34570105-34570127 CTGCATTTATATAGGGATTTAGG - Intronic
1179397511 21:41055322-41055344 ATGAATGTATAGAGGGGTTTGGG - Intergenic
1180947426 22:19704250-19704272 CTGTTTTTAAAGAGGGGTTTTGG + Intergenic
1183212569 22:36459931-36459953 ATGGAGGTACAGAGGGCTTTGGG - Intergenic
949607501 3:5670386-5670408 CTGCATGTAAAGATGGTTTTTGG - Intergenic
949990150 3:9572242-9572264 CTGTCTGCACATAGGGCTTTTGG + Intergenic
953971049 3:47347250-47347272 CTGTCTCTAGAGAGGGACTTAGG - Intergenic
954253409 3:49386141-49386163 CTGAATCTACAGATCGATTTGGG + Intronic
957107913 3:75914634-75914656 ATTTATGTGCAAAGGGATTTTGG - Intronic
958032108 3:88123872-88123894 CTGTATGTCTAGAGTAATTTGGG + Intronic
959090916 3:101901840-101901862 CTGTATTTCCAAAGGGATTAAGG + Intergenic
959254262 3:103990383-103990405 CTGCAAGCACAGAGAGATTTGGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960754350 3:120993864-120993886 TTGAATGTACAGATGGCTTTGGG + Intronic
962513365 3:136125456-136125478 CTGGCTTTACAGAGTGATTTTGG - Intronic
964156580 3:153592300-153592322 CTGTAGGTAGAAAGAGATTTTGG - Intergenic
965096654 3:164237235-164237257 CTGCATGTAGAGAATGATTTTGG + Intergenic
965978033 3:174649702-174649724 ATGTATGTATAAAGGAATTTGGG - Intronic
966545708 3:181144911-181144933 CTGTAAGTATATGGGGATTTGGG - Intergenic
968909884 4:3472379-3472401 CTGCATGCTCACAGGGATTTGGG + Intronic
969369461 4:6722327-6722349 TTGTATGTACTGCGGGATTTAGG + Intergenic
971157828 4:24102431-24102453 TTGTATGAACAGAGAAATTTGGG + Intergenic
972111745 4:35570322-35570344 CTGTAAGTAGGGAGGGAGTTGGG - Intergenic
972528057 4:39935473-39935495 CTGTATGTACTGAAAGCTTTTGG + Intronic
973267344 4:48224124-48224146 CTGAATGTACAGGTGGAGTTGGG + Intronic
973829677 4:54746060-54746082 CTGGATTTACAGAGGGGTGTGGG + Intergenic
974711784 4:65606938-65606960 CTGTATTTAAAGAGGCAGTTAGG - Intronic
976952759 4:90852984-90853006 CTGTATTTATACAGTGATTTGGG + Intronic
979955407 4:126948151-126948173 CTGTATTTAAAGCAGGATTTTGG - Intergenic
981888007 4:149701032-149701054 AAGCATGTAAAGAGGGATTTGGG - Intergenic
982232369 4:153221503-153221525 GTGTATGGACAGAGGGTTATAGG - Intronic
982839354 4:160162957-160162979 CTGTAAGTAAAGAGATATTTGGG + Intergenic
985409382 4:189667307-189667329 CTGTTTCTGCAGAGGGATTTGGG + Intergenic
986821184 5:11468523-11468545 CTGTATCTACAGAGAGATCTGGG - Intronic
987819634 5:22946331-22946353 CTGAATCTACAGAGGAACTTGGG + Intergenic
992140525 5:73792472-73792494 CTGTATGTACAGAATTCTTTAGG + Intronic
993483488 5:88453049-88453071 CTGTTTGTACAGAGAGATCCAGG + Intergenic
994102799 5:95912126-95912148 GTGTATGGACTGTGGGATTTTGG + Intronic
994206962 5:97046066-97046088 CTGTAATTACAGAGTGATGTCGG + Intergenic
994784335 5:104136808-104136830 CTATTTGTGCAGAGGGATTAAGG - Intergenic
995901160 5:117068034-117068056 ATGTATGTACATATGTATTTTGG - Intergenic
996209041 5:120782309-120782331 CTGCATGTATGGAGGGATTGTGG - Intergenic
1000095366 5:157966806-157966828 CTGGCTGCTCAGAGGGATTTGGG - Intergenic
1000579594 5:163018887-163018909 CTGAATTTTCAGAGTGATTTTGG + Intergenic
1000600040 5:163261818-163261840 CTGTCTGTACACACGGATGTTGG - Intergenic
1002876325 6:1213738-1213760 CTGTATCTCAATAGGGATTTCGG + Intergenic
1006677528 6:35775181-35775203 CTTTATGTACAGTCTGATTTGGG - Intergenic
1006960962 6:37929578-37929600 CTGTATGAAAAGAGGGAATGTGG + Intronic
1008621227 6:53273345-53273367 CTGCAGGAACAGAGGGATTTGGG + Intronic
1009164154 6:60320277-60320299 CAGTCTGTATAGAGGGACTTAGG + Intergenic
1010386988 6:75291478-75291500 CAGTATCTACAGAGGCATTTGGG - Intergenic
1011043889 6:83060474-83060496 ATGTATGTACATAGGTATGTAGG + Intronic
1011992682 6:93542848-93542870 TTGTATGTACAGAGGCACATTGG + Intergenic
1013001363 6:106026023-106026045 CTGTATTAACAGAGGTACTTAGG + Intergenic
1013883879 6:114938236-114938258 CTCTATGTAGAGAAGCATTTGGG + Intergenic
1014921553 6:127219791-127219813 CTATGGGTACAGAGAGATTTAGG + Intergenic
1016931222 6:149412267-149412289 CTGTATGTTTAAAGGGGTTTGGG + Intergenic
1017767247 6:157616633-157616655 CTGAAGGGACAGAGGGATTGTGG + Intronic
1018789246 6:167133671-167133693 TTGTATCTACAGATCGATTTGGG + Intronic
1019295919 7:274871-274893 TTTTATGAACAGATGGATTTTGG - Intergenic
1020892401 7:13895609-13895631 GTGAATGGGCAGAGGGATTTGGG - Exonic
1026382533 7:69813877-69813899 CTGTGGGCACACAGGGATTTTGG + Intronic
1029854697 7:103503742-103503764 CTGTTAATACAGTGGGATTTAGG + Intronic
1030535360 7:110759669-110759691 ATGTATGTACAGACAGACTTAGG + Intronic
1038122109 8:24628924-24628946 CTGGAAGAACAGAGAGATTTGGG + Intergenic
1038787063 8:30627734-30627756 CTGTATGTAGCAAGAGATTTAGG - Intronic
1039394855 8:37216849-37216871 CTGTATGTTCAGAGCTAATTAGG + Intergenic
1042407351 8:68421482-68421504 CTGGATGTACAGTAGGAGTTGGG - Intronic
1044058606 8:87604266-87604288 GTGTGTGTTGAGAGGGATTTAGG - Intronic
1047628505 8:126680872-126680894 CTGTATGCACACAGGTTTTTTGG - Intergenic
1048586222 8:135776632-135776654 ATGTATGTGTAGGGGGATTTTGG + Intergenic
1048730526 8:137435265-137435287 ATGTATGTACATAAGAATTTAGG - Intergenic
1049348869 8:142153487-142153509 CTGTTCATACAGAGGGGTTTGGG - Intergenic
1052116207 9:24651300-24651322 CTGTTTTTACAGACTGATTTAGG + Intergenic
1053587488 9:39475423-39475445 TTGAATGTACACAGGTATTTTGG + Intergenic
1054578810 9:66889814-66889836 TTGAATGTACACAGGTATTTTGG - Intronic
1057915413 9:99051693-99051715 CCGTAAGCACAGAAGGATTTTGG + Intronic
1058812061 9:108650081-108650103 CTGTATTTTCAGACGGATTCAGG - Intergenic
1060689324 9:125642673-125642695 CTGCATGTGCAAGGGGATTTGGG - Intronic
1203662175 Un_KI270753v1:55137-55159 CTGTTTCTGCAGAGGGATTTGGG - Intergenic
1186952728 X:14645260-14645282 CTGTATGTAAAGAGGGTTTGTGG - Intronic
1191780852 X:64863604-64863626 ATGTGTGTGCAGAGGGGTTTAGG + Intergenic
1192617793 X:72646041-72646063 CTGCATGTATAGAGGGAGGTGGG + Intronic
1195279189 X:103313526-103313548 CTGAATTTACAGATGAATTTGGG - Intergenic
1195916124 X:109937422-109937444 ATGTATGTACAAAGGGTTATGGG - Intergenic
1197824675 X:130576028-130576050 CTGTATGAACAGGAGCATTTCGG - Intergenic
1200877090 Y:8168563-8168585 CTGTATGAACAAAGGGAATCAGG + Intergenic