ID: 1118183124

View in Genome Browser
Species Human (GRCh38)
Location 14:63513424-63513446
Sequence TGAGAAGCACACTTAGTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118183124_1118183125 -5 Left 1118183124 14:63513424-63513446 CCACTCACTAAGTGTGCTTCTCA 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1118183125 14:63513442-63513464 TCTCATGTTACATAAAACTTTGG 0: 1
1: 4
2: 7
3: 25
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118183124 Original CRISPR TGAGAAGCACACTTAGTGAG TGG (reversed) Intronic
903127476 1:21257736-21257758 TGAGAAGCCCACTCAGGGACGGG + Intronic
903970306 1:27114365-27114387 TGAGGAGCGCAGTTGGTGAGAGG + Intronic
907443747 1:54494451-54494473 AAAGAAGCACAGTTGGTGAGTGG + Intergenic
907618456 1:55949915-55949937 TAAGAATCACACTTCGAGAGTGG - Intergenic
909027085 1:70494519-70494541 TTAGAGGCAAACTGAGTGAGAGG - Intergenic
911590535 1:99742823-99742845 TTAGAAGCATACACAGTGAGTGG - Intronic
915083640 1:153369443-153369465 GGAGAACATCACTTAGTGAGAGG - Intergenic
915184713 1:154095292-154095314 TGAGAAGCATTCCAAGTGAGAGG - Intronic
917312147 1:173689471-173689493 TGAGAAGCTCACTTAGAGGACGG + Intergenic
919394245 1:197024227-197024249 TGAGAAGCAAATTTGTTGAGTGG - Intergenic
920197992 1:204242226-204242248 TGAAAAGGGCACTTAGTGTGTGG + Intronic
922573584 1:226647556-226647578 TCAGAATTACAGTTAGTGAGTGG - Intronic
924659574 1:246004039-246004061 TGAGAAGGCCCCTTAGTAAGTGG - Intronic
1063145587 10:3292441-3292463 TGAGAACCTCACCAAGTGAGAGG + Intergenic
1063725519 10:8633281-8633303 AGAGAAGCACATTTAGAGAAAGG + Intergenic
1071974535 10:90941581-90941603 TGAGAACCCCACCTGGTGAGGGG + Intergenic
1073218926 10:101853464-101853486 TGAGGGCCACACTTAGGGAGAGG + Intronic
1073423949 10:103445062-103445084 TGAGAAACATACATAGTGAAGGG - Intronic
1077390191 11:2297218-2297240 TGAGAAGCAACCTCAGTGGGTGG - Exonic
1078545636 11:12245225-12245247 AGAGAAGCACAGTTGGTGGGTGG - Intronic
1081987589 11:47317591-47317613 TGGGAAGAATACTTAATGAGTGG + Intronic
1084276134 11:68051875-68051897 TGAGCAGCACTCGTGGTGAGTGG + Intergenic
1090454710 11:126838567-126838589 TGAGAATCACACTTGATCAGAGG - Intronic
1090531882 11:127599537-127599559 TCAGCAGCACACGGAGTGAGTGG - Intergenic
1090600875 11:128369864-128369886 TGAGACTCACACATAGTGAAAGG - Intergenic
1093815796 12:23545211-23545233 TGAGATGCATACTTTGAGAGGGG - Intronic
1096174941 12:49508549-49508571 TGTTAAGCCCCCTTAGTGAGTGG - Intronic
1098643257 12:72864609-72864631 TGAAATGGACACTTAGTCAGAGG + Intergenic
1103063067 12:117874704-117874726 TGAGAAGCACAATTAGAAAAGGG + Intronic
1106559304 13:30834584-30834606 AGAGAAGCACCCTAAGTGCGTGG + Intergenic
1106901293 13:34357173-34357195 TGAGAAGCACAGTAAGAAAGGGG + Intergenic
1107229393 13:38089610-38089632 TGAGAAGCACTCTTGAAGAGAGG - Intergenic
1111005304 13:82239978-82240000 TGAGTAGCCCCCTTTGTGAGAGG - Intergenic
1112827429 13:103408023-103408045 TGAGAAGCTCACTTACTGGAAGG + Intergenic
1118183124 14:63513424-63513446 TGAGAAGCACACTTAGTGAGTGG - Intronic
1118566958 14:67151960-67151982 AGAGAAGTACACTTTATGAGTGG - Intronic
1118775123 14:68969050-68969072 TGCCAAGCAGACTCAGTGAGGGG + Intronic
1118890664 14:69905839-69905861 AGAGAAGCAGACTTGATGAGGGG + Intronic
1120711097 14:87793762-87793784 AGAGAAGCAGGCTAAGTGAGGGG - Intergenic
1125795992 15:42404216-42404238 TGAGTAGGAAACTGAGTGAGAGG - Intronic
1131217726 15:90553343-90553365 TGAGAAGCACAGAGAGTTAGGGG + Intronic
1133838690 16:9389005-9389027 TAAGAAACACCCTGAGTGAGGGG + Intergenic
1141437609 16:84009289-84009311 GGAGGAGCTCACTTAGTGATGGG + Intergenic
1142534519 17:605251-605273 TGAGAAGAAAACTCAGGGAGTGG + Intronic
1145378479 17:22373810-22373832 TGAAAAGCACCCTTATTGTGGGG + Intergenic
1146213752 17:30962054-30962076 TGGGCAGCACACTCAGAGAGAGG - Intergenic
1148019609 17:44544815-44544837 TGAAACCCACACTTAGGGAGGGG - Intergenic
1156162700 18:34379136-34379158 TGAGAAATACAATTAGTGACTGG - Intergenic
1157964117 18:52188916-52188938 TAAGAACAACACTTATTGAGTGG - Intergenic
1160291017 18:77593832-77593854 TGATAAGCACACTGGCTGAGTGG + Intergenic
1161349750 19:3785162-3785184 TGAGAGGCACACTGAGCAAGTGG + Intronic
1162268373 19:9594621-9594643 TGAGAAGCTCACTTAGAGGACGG + Intergenic
1162892653 19:13745122-13745144 TAAGTCGCACAGTTAGTGAGGGG - Intronic
1166385064 19:42376223-42376245 AGAGGAGCACACAGAGTGAGAGG - Exonic
927714535 2:25343029-25343051 TGAGATGAGCACATAGTGAGTGG - Intergenic
928906606 2:36374801-36374823 TCAGATGCACAGGTAGTGAGTGG - Intronic
931744287 2:65278424-65278446 TGAGAAGAACACTTGGGGAGGGG + Intergenic
935048021 2:99499131-99499153 TGAGAAGCTCACTTAGGGGAGGG - Intergenic
935354986 2:102189541-102189563 GGACAAACACACTTTGTGAGTGG - Intronic
936670467 2:114650492-114650514 TGAAAAGCACACTTAATGATGGG - Intronic
938967508 2:136401586-136401608 TCAGAAGCACACTTAGGAAGGGG + Intergenic
940047575 2:149425806-149425828 TAATTAGCACACTTAGTTAGAGG - Intronic
942125798 2:172823697-172823719 GGAGAAGCGAACTTAGTGACAGG - Intronic
943554980 2:189391887-189391909 TGAGATGCACAGTTAGTGTAAGG - Intergenic
948677506 2:239607423-239607445 AGAAAAGCACACAAAGTGAGAGG - Intergenic
1169693140 20:8356259-8356281 TGAGACGCACTCTTAGAGACTGG - Intronic
1170759567 20:19237711-19237733 TGAGATTCACTCTTGGTGAGAGG + Intronic
1173569673 20:44068153-44068175 TGAGAAGGAAACTTAGGGACAGG - Intronic
1174872844 20:54199556-54199578 GGTGAAGCACAGTGAGTGAGGGG + Intergenic
1181769194 22:25113194-25113216 GGGGAAGCACAGTGAGTGAGTGG + Intronic
949098948 3:120058-120080 TCTGCAGCACTCTTAGTGAGTGG - Intergenic
950846650 3:16021913-16021935 TGAGAAGCTCACTTAGAGGATGG + Intergenic
952874786 3:37935617-37935639 TGAGAAGCAGAATTAGTGAGAGG + Intronic
954849689 3:53589912-53589934 TGAGGAGCACACTAAGTTAGAGG - Intronic
959650207 3:108744053-108744075 TGAGTAGCACAGGTAGAGAGTGG - Intronic
961582344 3:127893010-127893032 TGAGAAGCTCACTTAGGGCATGG - Intergenic
962954576 3:140252677-140252699 TGAGAAGCACAGTTATGCAGAGG + Intronic
967556907 3:190870735-190870757 AGGGAAGCACATTGAGTGAGAGG + Intronic
970503422 4:16702474-16702496 GGAGGAGCACATTGAGTGAGAGG - Intronic
971920346 4:32931320-32931342 TAAGAAGCACAGCTAGTTAGTGG + Intergenic
978150755 4:105431794-105431816 TCAAAAGCACACTAAGTGAAAGG + Intronic
978746710 4:112202747-112202769 CCAGAAGAACTCTTAGTGAGAGG - Intergenic
980416906 4:132501119-132501141 TGAGAGGCACACCTGGTTAGGGG - Intergenic
980951837 4:139387278-139387300 TAAGAAGCAGACTTACTTAGGGG + Intronic
983391507 4:167136889-167136911 TGAGAAGATGGCTTAGTGAGTGG + Intronic
986494798 5:8331624-8331646 TGAGCAGGACAATAAGTGAGTGG - Intergenic
986740681 5:10702628-10702650 TGATAAGCACAATTAGCTAGAGG + Intronic
987151345 5:15043897-15043919 TAAGATGCACATTTAGTGACTGG - Intergenic
987278452 5:16387401-16387423 TCAGAAGCATATTTACTGAGGGG + Intergenic
987686055 5:21203483-21203505 TGTGAAGCAAGCTTACTGAGGGG + Intergenic
990997207 5:61744867-61744889 TGAGAAGAACACCTGGTCAGGGG - Intronic
991516248 5:67438824-67438846 TGTGAAGAACACTGAGTAAGAGG - Intergenic
993879636 5:93347432-93347454 TGAGAAGCACACTAAATGGTGGG + Intergenic
994858254 5:105154036-105154058 TCAGAAGCTCACTTAATCAGAGG - Intergenic
997848530 5:137310095-137310117 TGAGACACACAGCTAGTGAGTGG - Intronic
1000478106 5:161737416-161737438 TAAGAAGAGCACTCAGTGAGAGG - Intergenic
1003218168 6:4134434-4134456 TTTTAAGCACACATAGTGAGCGG + Intronic
1005490122 6:26340354-26340376 TGAAAACCAAAGTTAGTGAGGGG - Intergenic
1007069147 6:39022470-39022492 TGGGAAGCACCCTGATTGAGTGG - Intronic
1010606406 6:77894111-77894133 TTAGAAGCAGACTTATTGAATGG + Intronic
1010715268 6:79221726-79221748 GGAGAAGGACACTGAGGGAGAGG + Intronic
1011438684 6:87365568-87365590 TGAGAAGAAAAAATAGTGAGAGG + Intronic
1012679519 6:102161812-102161834 TGAGAAGCACAGGTAAAGAGAGG + Intergenic
1018126483 6:160687762-160687784 TGAGAAGCAGAGTTGGGGAGAGG + Intergenic
1020069692 7:5218285-5218307 TTAGAAACACACTGGGTGAGCGG - Intronic
1021111730 7:16702547-16702569 TGAAAAGCACACTAAATGATAGG - Intronic
1022205206 7:28157233-28157255 TGATAAGCAGACAAAGTGAGAGG + Intronic
1024042906 7:45568783-45568805 TGGGAAGCAGACTGAGTGAGAGG - Intergenic
1024903918 7:54354212-54354234 TGAGAAACACACATAGAAAGAGG + Intergenic
1025104207 7:56157563-56157585 TGACAAGGGCACTTAGGGAGTGG - Intergenic
1026316581 7:69232675-69232697 TGACAAGGGCACTTAGGGAGTGG + Intergenic
1027574016 7:79908932-79908954 TCATAAGAAAACTTAGTGAGTGG - Intergenic
1028108067 7:86903957-86903979 AAAGAAGCACACTAAGTTAGAGG - Intronic
1031374243 7:121004627-121004649 TGAGAAGCACATTTTGTGGTTGG + Intronic
1033881164 7:145885955-145885977 TGGGTAGCACAATTAGTGACCGG - Intergenic
1034656125 7:152730833-152730855 TGAGAGGATCACTTAGTGACAGG - Intergenic
1035077993 7:156193672-156193694 TGGGAAGCACACAGAGTGATAGG - Intergenic
1043520961 8:81044812-81044834 TGAGAAGCAAATTTAGGTAGAGG - Intronic
1046115943 8:109783282-109783304 TCTGAAGCTCAGTTAGTGAGGGG - Intergenic
1047885672 8:129247668-129247690 GGAGAAGCACATTCATTGAGTGG + Intergenic
1048582747 8:135743838-135743860 TGAGAAGCACACAGAAAGAGAGG + Intergenic
1050338692 9:4614455-4614477 TGAAAAGAACACTGAGTGAGTGG + Intronic
1051037009 9:12760037-12760059 TGAGAAGCACACAGAATGAGTGG - Intergenic
1051118178 9:13721544-13721566 TGAGAAGAGCACCTAGGGAGTGG + Intergenic
1052823668 9:33159618-33159640 GGAGAAGCTCTCTTAGGGAGAGG - Intronic
1058203660 9:102074566-102074588 TGTTAAGCACATTGAGTGAGGGG - Intergenic
1059160975 9:112034906-112034928 TGAGAAGCAGAGATAGGGAGAGG - Intergenic
1187236552 X:17473135-17473157 TGAGAACCCAACTTAGTAAGTGG + Intronic
1188787926 X:34371719-34371741 TCAGTAGCAAAATTAGTGAGTGG + Intergenic
1189034224 X:37479471-37479493 TGAGAAGCTCACTTAGGGGACGG - Intronic
1189834211 X:45004424-45004446 TGAGAAGCTCACTTAGGGGACGG + Intronic
1194268158 X:91779732-91779754 TGAGGTCCACACTTAGTGCGCGG + Intronic
1196084874 X:111674089-111674111 TGAGGGGCATACATAGTGAGAGG + Intronic
1197845099 X:130793026-130793048 TAAGTGGCACACTTAGTAAGTGG - Intronic
1200074573 X:153544749-153544771 GGAGAAGCACACTTGGAGAAAGG - Intronic
1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG + Intronic
1201328489 Y:12792844-12792866 TAAGAAGCACATTCAGTGATAGG - Intronic
1201986729 Y:19976795-19976817 AGAAAAGCACACTGAGTGAAGGG + Intergenic