ID: 1118186644

View in Genome Browser
Species Human (GRCh38)
Location 14:63543577-63543599
Sequence GGCTGCACCGCCCGAGATCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118186644_1118186645 -8 Left 1118186644 14:63543577-63543599 CCGCGATCTCGGGCGGTGCAGCC No data
Right 1118186645 14:63543592-63543614 GTGCAGCCGCCGCTTCCGCCCGG No data
1118186644_1118186649 0 Left 1118186644 14:63543577-63543599 CCGCGATCTCGGGCGGTGCAGCC No data
Right 1118186649 14:63543600-63543622 GCCGCTTCCGCCCGGCAGTGGGG No data
1118186644_1118186648 -1 Left 1118186644 14:63543577-63543599 CCGCGATCTCGGGCGGTGCAGCC No data
Right 1118186648 14:63543599-63543621 CGCCGCTTCCGCCCGGCAGTGGG No data
1118186644_1118186647 -2 Left 1118186644 14:63543577-63543599 CCGCGATCTCGGGCGGTGCAGCC No data
Right 1118186647 14:63543598-63543620 CCGCCGCTTCCGCCCGGCAGTGG No data
1118186644_1118186655 25 Left 1118186644 14:63543577-63543599 CCGCGATCTCGGGCGGTGCAGCC No data
Right 1118186655 14:63543625-63543647 AGCTGAAGTGAGAAGCCGCTGGG No data
1118186644_1118186654 24 Left 1118186644 14:63543577-63543599 CCGCGATCTCGGGCGGTGCAGCC No data
Right 1118186654 14:63543624-63543646 AAGCTGAAGTGAGAAGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118186644 Original CRISPR GGCTGCACCGCCCGAGATCG CGG (reversed) Intergenic
No off target data available for this crispr