ID: 1118187816

View in Genome Browser
Species Human (GRCh38)
Location 14:63553581-63553603
Sequence AGTTATGGTGATGGAAGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118187816_1118187822 12 Left 1118187816 14:63553581-63553603 CCAAGTCTTCCATCACCATAACT No data
Right 1118187822 14:63553616-63553638 ACACTATGAGCTAGGAACTGTGG No data
1118187816_1118187821 4 Left 1118187816 14:63553581-63553603 CCAAGTCTTCCATCACCATAACT No data
Right 1118187821 14:63553608-63553630 TTCATTGAACACTATGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118187816 Original CRISPR AGTTATGGTGATGGAAGACT TGG (reversed) Intergenic
No off target data available for this crispr