ID: 1118187817

View in Genome Browser
Species Human (GRCh38)
Location 14:63553590-63553612
Sequence ATGAATGGGAGTTATGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118187817_1118187822 3 Left 1118187817 14:63553590-63553612 CCATCACCATAACTCCCATTCAT No data
Right 1118187822 14:63553616-63553638 ACACTATGAGCTAGGAACTGTGG No data
1118187817_1118187821 -5 Left 1118187817 14:63553590-63553612 CCATCACCATAACTCCCATTCAT No data
Right 1118187821 14:63553608-63553630 TTCATTGAACACTATGAGCTAGG No data
1118187817_1118187823 29 Left 1118187817 14:63553590-63553612 CCATCACCATAACTCCCATTCAT No data
Right 1118187823 14:63553642-63553664 ACACTTTACTTGTATTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118187817 Original CRISPR ATGAATGGGAGTTATGGTGA TGG (reversed) Intergenic
No off target data available for this crispr