ID: 1118187821

View in Genome Browser
Species Human (GRCh38)
Location 14:63553608-63553630
Sequence TTCATTGAACACTATGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118187817_1118187821 -5 Left 1118187817 14:63553590-63553612 CCATCACCATAACTCCCATTCAT No data
Right 1118187821 14:63553608-63553630 TTCATTGAACACTATGAGCTAGG No data
1118187816_1118187821 4 Left 1118187816 14:63553581-63553603 CCAAGTCTTCCATCACCATAACT No data
Right 1118187821 14:63553608-63553630 TTCATTGAACACTATGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118187821 Original CRISPR TTCATTGAACACTATGAGCT AGG Intergenic
No off target data available for this crispr