ID: 1118191066 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:63580853-63580875 |
| Sequence | GACTGGAGTGTGAAGTAAAG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1118191066_1118191075 | 28 | Left | 1118191066 | 14:63580853-63580875 | CCTCTTTACTTCACACTCCAGTC | No data | ||
| Right | 1118191075 | 14:63580904-63580926 | GTGCAGCAAGCTAGACAGCAGGG | No data | ||||
| 1118191066_1118191074 | 27 | Left | 1118191066 | 14:63580853-63580875 | CCTCTTTACTTCACACTCCAGTC | No data | ||
| Right | 1118191074 | 14:63580903-63580925 | TGTGCAGCAAGCTAGACAGCAGG | 0: 1 1: 0 2: 0 3: 8 4: 102 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1118191066 | Original CRISPR | GACTGGAGTGTGAAGTAAAG AGG (reversed) | Intergenic | ||