ID: 1118191070

View in Genome Browser
Species Human (GRCh38)
Location 14:63580875-63580897
Sequence CTCACTGAAGCCCTCTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118191070_1118191076 21 Left 1118191070 14:63580875-63580897 CCCCATCAGAGGGCTTCAGTGAG No data
Right 1118191076 14:63580919-63580941 CAGCAGGGAATCTTCCACTTAGG No data
1118191070_1118191074 5 Left 1118191070 14:63580875-63580897 CCCCATCAGAGGGCTTCAGTGAG No data
Right 1118191074 14:63580903-63580925 TGTGCAGCAAGCTAGACAGCAGG No data
1118191070_1118191075 6 Left 1118191070 14:63580875-63580897 CCCCATCAGAGGGCTTCAGTGAG No data
Right 1118191075 14:63580904-63580926 GTGCAGCAAGCTAGACAGCAGGG No data
1118191070_1118191077 22 Left 1118191070 14:63580875-63580897 CCCCATCAGAGGGCTTCAGTGAG No data
Right 1118191077 14:63580920-63580942 AGCAGGGAATCTTCCACTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118191070 Original CRISPR CTCACTGAAGCCCTCTGATG GGG (reversed) Intergenic
No off target data available for this crispr