ID: 1118191073

View in Genome Browser
Species Human (GRCh38)
Location 14:63580898-63580920
Sequence TGTCTAGCTTGCTGCACACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118191073_1118191077 -1 Left 1118191073 14:63580898-63580920 CCTCGTGTGCAGCAAGCTAGACA No data
Right 1118191077 14:63580920-63580942 AGCAGGGAATCTTCCACTTAGGG No data
1118191073_1118191078 9 Left 1118191073 14:63580898-63580920 CCTCGTGTGCAGCAAGCTAGACA No data
Right 1118191078 14:63580930-63580952 CTTCCACTTAGGGTGTGACGAGG No data
1118191073_1118191076 -2 Left 1118191073 14:63580898-63580920 CCTCGTGTGCAGCAAGCTAGACA No data
Right 1118191076 14:63580919-63580941 CAGCAGGGAATCTTCCACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118191073 Original CRISPR TGTCTAGCTTGCTGCACACG AGG (reversed) Intergenic
No off target data available for this crispr