ID: 1118191074

View in Genome Browser
Species Human (GRCh38)
Location 14:63580903-63580925
Sequence TGTGCAGCAAGCTAGACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118191072_1118191074 3 Left 1118191072 14:63580877-63580899 CCATCAGAGGGCTTCAGTGAGCC No data
Right 1118191074 14:63580903-63580925 TGTGCAGCAAGCTAGACAGCAGG No data
1118191064_1118191074 29 Left 1118191064 14:63580851-63580873 CCCCTCTTTACTTCACACTCCAG No data
Right 1118191074 14:63580903-63580925 TGTGCAGCAAGCTAGACAGCAGG No data
1118191070_1118191074 5 Left 1118191070 14:63580875-63580897 CCCCATCAGAGGGCTTCAGTGAG No data
Right 1118191074 14:63580903-63580925 TGTGCAGCAAGCTAGACAGCAGG No data
1118191071_1118191074 4 Left 1118191071 14:63580876-63580898 CCCATCAGAGGGCTTCAGTGAGC No data
Right 1118191074 14:63580903-63580925 TGTGCAGCAAGCTAGACAGCAGG No data
1118191069_1118191074 10 Left 1118191069 14:63580870-63580892 CCAGTCCCCATCAGAGGGCTTCA No data
Right 1118191074 14:63580903-63580925 TGTGCAGCAAGCTAGACAGCAGG No data
1118191065_1118191074 28 Left 1118191065 14:63580852-63580874 CCCTCTTTACTTCACACTCCAGT No data
Right 1118191074 14:63580903-63580925 TGTGCAGCAAGCTAGACAGCAGG No data
1118191066_1118191074 27 Left 1118191066 14:63580853-63580875 CCTCTTTACTTCACACTCCAGTC No data
Right 1118191074 14:63580903-63580925 TGTGCAGCAAGCTAGACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118191074 Original CRISPR TGTGCAGCAAGCTAGACAGC AGG Intergenic
No off target data available for this crispr