ID: 1118191077

View in Genome Browser
Species Human (GRCh38)
Location 14:63580920-63580942
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118191071_1118191077 21 Left 1118191071 14:63580876-63580898 CCCATCAGAGGGCTTCAGTGAGC No data
Right 1118191077 14:63580920-63580942 AGCAGGGAATCTTCCACTTAGGG No data
1118191069_1118191077 27 Left 1118191069 14:63580870-63580892 CCAGTCCCCATCAGAGGGCTTCA No data
Right 1118191077 14:63580920-63580942 AGCAGGGAATCTTCCACTTAGGG No data
1118191073_1118191077 -1 Left 1118191073 14:63580898-63580920 CCTCGTGTGCAGCAAGCTAGACA No data
Right 1118191077 14:63580920-63580942 AGCAGGGAATCTTCCACTTAGGG No data
1118191072_1118191077 20 Left 1118191072 14:63580877-63580899 CCATCAGAGGGCTTCAGTGAGCC No data
Right 1118191077 14:63580920-63580942 AGCAGGGAATCTTCCACTTAGGG No data
1118191070_1118191077 22 Left 1118191070 14:63580875-63580897 CCCCATCAGAGGGCTTCAGTGAG No data
Right 1118191077 14:63580920-63580942 AGCAGGGAATCTTCCACTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118191077 Original CRISPR AGCAGGGAATCTTCCACTTA GGG Intergenic
No off target data available for this crispr