ID: 1118191078

View in Genome Browser
Species Human (GRCh38)
Location 14:63580930-63580952
Sequence CTTCCACTTAGGGTGTGACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118191073_1118191078 9 Left 1118191073 14:63580898-63580920 CCTCGTGTGCAGCAAGCTAGACA No data
Right 1118191078 14:63580930-63580952 CTTCCACTTAGGGTGTGACGAGG No data
1118191072_1118191078 30 Left 1118191072 14:63580877-63580899 CCATCAGAGGGCTTCAGTGAGCC No data
Right 1118191078 14:63580930-63580952 CTTCCACTTAGGGTGTGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118191078 Original CRISPR CTTCCACTTAGGGTGTGACG AGG Intergenic
No off target data available for this crispr