ID: 1118193409

View in Genome Browser
Species Human (GRCh38)
Location 14:63602096-63602118
Sequence GTACTAACTCAAGAACTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118193409 Original CRISPR GTACTAACTCAAGAACTGTT AGG Intronic