ID: 1118195322

View in Genome Browser
Species Human (GRCh38)
Location 14:63620269-63620291
Sequence ATCCTGTCATTTGTGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 6, 2: 24, 3: 81, 4: 335}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118195319_1118195322 0 Left 1118195319 14:63620246-63620268 CCTCAGCCTTAAAAAAGAACAAA 0: 1
1: 2
2: 19
3: 148
4: 1360
Right 1118195322 14:63620269-63620291 ATCCTGTCATTTGTGAAACAGGG 0: 1
1: 6
2: 24
3: 81
4: 335
1118195320_1118195322 -6 Left 1118195320 14:63620252-63620274 CCTTAAAAAAGAACAAAATCCTG 0: 10
1: 346
2: 1602
3: 4951
4: 9255
Right 1118195322 14:63620269-63620291 ATCCTGTCATTTGTGAAACAGGG 0: 1
1: 6
2: 24
3: 81
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118195322 Original CRISPR ATCCTGTCATTTGTGAAACA GGG Intronic
902719407 1:18294142-18294164 ATCCTGGCATTAGTGAAATCTGG + Intronic
903135826 1:21308653-21308675 ACCTCCTCATTTGTGAAACAGGG + Intronic
904743702 1:32697818-32697840 AAGCTGTCATTTGTGTCACAAGG - Intronic
905781294 1:40712583-40712605 ATCCTGTCAATTTTCAAGCATGG + Intronic
905871620 1:41407644-41407666 ATTATGTCATTTCTGAAAAAGGG - Intergenic
906020292 1:42622244-42622266 ATCCTGTCATTTGCAATACATGG - Intronic
907029788 1:51159435-51159457 ATCCTGTCATTGCAGCAACATGG - Intergenic
907737661 1:57130591-57130613 ATCCTGTCATTTGGAGAACATGG + Intronic
908187897 1:61670216-61670238 ATCATGTCCTTTGCGCAACATGG + Intergenic
909161618 1:72158176-72158198 ACGCTGTCACTTGTGAAAGATGG + Intronic
909263467 1:73526125-73526147 ATCCTGCCATTTGCCACACATGG - Intergenic
910120853 1:83788526-83788548 GTCTTGTCATTTATTAAACAGGG + Intergenic
910781197 1:90935846-90935868 ATCCTGTGATTTGAACAACACGG + Intronic
911065835 1:93787198-93787220 ATCCAGTCATTGGGGACACAGGG - Intronic
911667833 1:100574219-100574241 ATCATGTCTTTTGTGGAAGATGG + Intergenic
912600637 1:110929696-110929718 ATCATGTTTTTTGAGAAACATGG + Intergenic
913282384 1:117198765-117198787 TACCTGTCATTTGAGAAATACGG + Intronic
914933672 1:151959086-151959108 ATCCTGTCAAGTGAGAAAGAGGG - Intergenic
917072749 1:171170079-171170101 ATCCTGCCATTTTTTGAACATGG + Intergenic
917300408 1:173568436-173568458 ATCATGTCTTTTGTGGAACATGG - Intronic
917766849 1:178229434-178229456 ATCCTGACATTTTTGAAGCAAGG + Intronic
918129682 1:181615677-181615699 ATCCTGTCATCTGTGAATAATGG + Intronic
919833607 1:201558903-201558925 ATCCTGTGCTTTGAGAAAGATGG + Intergenic
920763047 1:208804275-208804297 ATCCTGTCTTTTAGGTAACATGG - Intergenic
921427179 1:215017424-215017446 ATCTTATCATTTGTACAACATGG + Intronic
921701080 1:218269848-218269870 TTCCTTTCTTTTTTGAAACAGGG - Intergenic
923211768 1:231809902-231809924 ACCATGTCAATTGTCAAACAAGG + Intronic
923247918 1:232151223-232151245 TTCCTGTCATTTGGGAAACCTGG - Intergenic
924274301 1:242369895-242369917 CCCCTGTAATTTGTGAAACTTGG - Intronic
1062815132 10:493816-493838 AGACTGTCATCTGTGAAACAAGG - Intronic
1062997802 10:1883224-1883246 TTACTGTCATTTTTGAAACAGGG + Intergenic
1063012089 10:2032986-2033008 ATTATGTCATTTGTGAAAAAAGG + Intergenic
1063286964 10:4699745-4699767 AGCCTTTCATTTTTGCAACATGG + Intergenic
1063348345 10:5332597-5332619 ATCCTCTCATTTGAGCAACATGG - Intergenic
1063827485 10:9913932-9913954 ATTCTGTAATTTGAGATACACGG - Intergenic
1064459310 10:15518307-15518329 ATCCTGTCAATTGGCACACATGG + Intronic
1065073771 10:22055196-22055218 ATCCTGTCATTTGCAACACATGG - Intergenic
1065494129 10:26311730-26311752 GTTCTGTCATCTGTAAAACAGGG + Intergenic
1065700015 10:28415736-28415758 ATCATGTCTTTTGCGGAACATGG - Intergenic
1065865205 10:29909080-29909102 ATCCTGGCACTTGTGAAGTATGG + Intergenic
1067708696 10:48630721-48630743 ATCCTGTCTTCTGTGAAAAAAGG + Intronic
1068105163 10:52605874-52605896 ATCATGTCATCTGCAAAACAGGG + Intergenic
1068479036 10:57565280-57565302 ATTCTGTCATTTGTGAAACATGG - Intergenic
1068843049 10:61637741-61637763 ATTCAGTCATTTGTGAAACATGG - Intergenic
1069094743 10:64245156-64245178 ATCATGTCTTCTGTGAAAAATGG + Intergenic
1069235915 10:66072963-66072985 ATCCTGTCATTTGTGACAACAGG + Intronic
1069258513 10:66363951-66363973 GTTCTGTCATCTGTAAAACAAGG - Intronic
1069345971 10:67470255-67470277 ATCCTGTCATTTGCAAAACATGG - Intronic
1070531180 10:77338746-77338768 ATGATGTCATTTGTGAAATGAGG + Intronic
1070643372 10:78184823-78184845 ATGCTCTCATTTGTAAAACCGGG + Intergenic
1070686018 10:78482018-78482040 ATCATGTCATCTGTGAATAAAGG + Intergenic
1071496275 10:86169665-86169687 AGCCTGGGATTTCTGAAACATGG + Intronic
1072976195 10:100060946-100060968 ATCCTGTCATTTGCAAAAACAGG + Intronic
1073706820 10:105993107-105993129 ATCCTGTCATTGCAGCAACATGG + Intergenic
1074425157 10:113344258-113344280 ATCCTGTCATTTCAACAACATGG + Intergenic
1075160165 10:120017000-120017022 ATCCTGCCATTTGTGACAACAGG + Intergenic
1075377987 10:121994946-121994968 ATCTCTTCATTTGTGAAATAAGG + Intronic
1078936927 11:15960213-15960235 ATAGTCTCATTTGGGAAACACGG + Intergenic
1079133235 11:17761731-17761753 ATCCTGGCATTTGGGATCCATGG - Intronic
1079765804 11:24390910-24390932 ACACTGTCATTTGTGAACAAAGG + Intergenic
1079840129 11:25386651-25386673 ATCCTGCCAGTTGGAAAACAGGG - Intergenic
1080563477 11:33485932-33485954 ATCCTGTCATTTGTGATGACAGG - Intergenic
1081145337 11:39556517-39556539 ATCCTCTCATTTGTGACAACAGG + Intergenic
1081590945 11:44422721-44422743 TTCATGTCTTTTGTGAGACAAGG + Intergenic
1082188295 11:49210365-49210387 ATCTTCTCATTTGTAAAACGTGG + Intergenic
1082809850 11:57473287-57473309 GTCTTTTCATCTGTGAAACAAGG - Intronic
1084131826 11:67141977-67141999 ATTCTGTCATTTTCGGAACATGG - Intronic
1085669326 11:78447682-78447704 ATCCAGTCACTTGTGACACATGG + Intronic
1085836086 11:79958128-79958150 ATAATCTCATTTATGAAACACGG - Intergenic
1086123151 11:83321520-83321542 ATCCTGTTAGTTGTGTAACATGG - Intergenic
1086678222 11:89636278-89636300 ATCTTCTCATTTGTAAAACGTGG - Intergenic
1087517926 11:99189141-99189163 ATCCTGTTATTTGTGTAACATGG - Intronic
1089875700 11:121719706-121719728 ATGCTGTCATTGGAGAACCAGGG - Intergenic
1090183041 11:124717779-124717801 AGCCTGGGATTTTTGAAACAAGG - Intergenic
1090254272 11:125272416-125272438 GTCCTCTCAATTGTGAAACTGGG - Intronic
1091454278 12:594145-594167 ATCTTGTCATCTGTGAACAAAGG - Intronic
1092397330 12:8139203-8139225 ATCCTGTCATTTGCACAACATGG - Intronic
1092632557 12:10398212-10398234 ATCCTGTCATTTATACAACATGG - Intronic
1092733239 12:11554222-11554244 ATCCTGTGCTTCGTGCAACAAGG + Intergenic
1095186306 12:39204244-39204266 ATCATGTCTTTTGTGCAATATGG + Intergenic
1096899616 12:54862280-54862302 ATCCTGTCATCTGCAAAACATGG - Intergenic
1097520553 12:60664250-60664272 ATCTTGTCATTTTTGTAACATGG - Intergenic
1097538357 12:60902498-60902520 ATCCTGTCATTTGCAACACATGG + Intergenic
1097652012 12:62310537-62310559 ATCATGTCTTTTGAGCAACATGG - Intronic
1097703192 12:62841061-62841083 ATTCTGCCATTTTGGAAACATGG - Intronic
1099383268 12:81981791-81981813 ATCCTGTAATTTGTGACACAGGG + Intergenic
1100085948 12:90911115-90911137 ATCATGTCTTTTGAGCAACATGG + Intronic
1100538793 12:95538183-95538205 ATCCTGTCAAGTGTTAAACTCGG - Intronic
1100573442 12:95864892-95864914 TTCCTGTCTTTTAAGAAACAGGG - Intronic
1100675083 12:96857444-96857466 ATCATGTCTTTTGTGGAACATGG - Intronic
1101253080 12:102954257-102954279 TTCCTGTCATTTTTGAGAAATGG - Intronic
1102806917 12:115790124-115790146 ATCATGTCATTTGCAGAACATGG - Intergenic
1103882645 12:124178049-124178071 ATACTGCCATTTGTGAAGAAAGG + Intronic
1104294298 12:127497847-127497869 ATCCTGCCATTTATAAAACATGG + Intergenic
1105294833 13:19078727-19078749 ATCTTCTGATCTGTGAAACAAGG + Intergenic
1105727283 13:23177056-23177078 ATCCTGTCATTTTGAGAACATGG + Intergenic
1106354548 13:28967729-28967751 ATCATGTCATCTGGGTAACAAGG - Intronic
1107177753 13:37419597-37419619 ATTTTGTCATTTGTGAAACATGG + Intergenic
1107344088 13:39440605-39440627 TTGCTGTCATTTTTGAGACAGGG + Intronic
1107643538 13:42470252-42470274 ATCCTGTCATTTGCACAAGATGG + Intergenic
1108299946 13:49063615-49063637 TTCCTGGAATTTGTGATACAAGG - Intronic
1108527838 13:51300874-51300896 ATACTGTCAATAGTGAAGCAAGG - Intergenic
1108993139 13:56689678-56689700 ATCCTGTCATTTACACAACATGG + Intergenic
1110590484 13:77251426-77251448 ATGCTGTCATTTTTTAAACTGGG - Intronic
1110637535 13:77783231-77783253 ATCATGTCTTTCGTGAAACATGG + Intergenic
1110903026 13:80847883-80847905 ATCATGTCATTTGTGAATAAAGG + Intergenic
1111298299 13:86312746-86312768 CTCCTCTCTTTTGTCAAACAAGG - Intergenic
1111310447 13:86477339-86477361 ATCCTTTCTTTAGTGTAACAAGG + Intergenic
1111327700 13:86720928-86720950 ATCATGTCCTTTGTGCACCACGG + Intergenic
1111661117 13:91213002-91213024 ACCCTGGCAGCTGTGAAACAAGG - Intergenic
1111882073 13:93969878-93969900 ATCCTGTCATTTGCGCAACGTGG - Intronic
1112487141 13:99830130-99830152 ATCTAGTCATTTTAGAAACAAGG - Intronic
1112517220 13:100064692-100064714 ATCCTATCCTCTGTGAAACTAGG - Intergenic
1113307290 13:109092416-109092438 GTCATGTCGTTTGTGGAACATGG + Intronic
1113403705 13:110018955-110018977 CTCATGTCATTTGAGAAGCAAGG - Intergenic
1113644650 13:111984941-111984963 ATGCTTTCATTTGTCAAACAAGG - Intergenic
1114945651 14:27677140-27677162 ATCATGTCATCTGCAAAACAGGG - Intergenic
1115011668 14:28555614-28555636 ATCCTGTCATTTGCAAAACATGG + Intergenic
1115613078 14:35067337-35067359 ATTCTGTCATTTGTGCAACGTGG - Intronic
1115805780 14:37049563-37049585 TTCCTTTCCTTTTTGAAACAGGG - Intronic
1116153986 14:41179834-41179856 ACCCTGTAATTTGTGTAAGATGG + Intergenic
1117023758 14:51598704-51598726 ATAATGTTATTTGAGAAACATGG - Intronic
1117842464 14:59873980-59874002 ATCCTGTCATTTGCACAACATGG - Intergenic
1118012811 14:61627425-61627447 ATCCAGTCATTTTAAAAACATGG + Intronic
1118195322 14:63620269-63620291 ATCCTGTCATTTGTGAAACAGGG + Intronic
1119313787 14:73674031-73674053 TTACTGTAATGTGTGAAACATGG + Intronic
1119944558 14:78678979-78679001 ATCCTGACATTTTTGAAAGATGG - Intronic
1120161608 14:81151563-81151585 ATCCTGTCATTTGAGACAACAGG - Intergenic
1120304671 14:82753744-82753766 ATCATGTCATCTGTAAAAAAGGG - Intergenic
1120671679 14:87369507-87369529 ATACTGTCATTTGAAACACATGG + Intergenic
1121785340 14:96655108-96655130 ATCCTGTCACATGTACAACACGG - Intergenic
1123960878 15:25398587-25398609 ATGCTGTCATTTGTGACAGCAGG - Intronic
1124698082 15:31883688-31883710 ATCATGTCATCTGTGAGTCAAGG + Intergenic
1125362812 15:38881936-38881958 ATCATGTCATCTGTGAATAATGG + Intergenic
1126529124 15:49692170-49692192 ATTTTGTCATTTGGGAAATATGG - Intergenic
1126765722 15:52009095-52009117 ATCCTGTCCTTTGAGGAAGAAGG - Intronic
1126862354 15:52898078-52898100 ATTCTGTCATTTGCAACACATGG - Intergenic
1127023533 15:54777784-54777806 ATCCTTTCATTTGCAGAACATGG - Intergenic
1128955338 15:71936150-71936172 ATCCTATCATTTGGACAACATGG + Intronic
1129155206 15:73713358-73713380 ATCGTGTCTTTGGTGAAATAAGG - Exonic
1130878481 15:88034186-88034208 TTACTGTCATTTGTAAAACTTGG - Intronic
1132000600 15:98175743-98175765 ATACTATCAGTTGTGAAACTAGG + Intergenic
1133515821 16:6507654-6507676 ATCCTGTTATATGTCCAACATGG + Intronic
1133939573 16:10297132-10297154 ATCCTGTGTTTTGGGAGACACGG + Intergenic
1135795620 16:25439073-25439095 ATCATGTCATTTGTGAAGAAAGG + Intergenic
1136751596 16:32641173-32641195 ATCCTGTCATTCGTGACAACAGG - Intergenic
1137577024 16:49606814-49606836 CTCCTGCCATCTCTGAAACAAGG + Intronic
1138226700 16:55302217-55302239 AACCTGTCATTTGTGAAAACAGG - Intergenic
1139232794 16:65302456-65302478 ATCATGTCATCTGTGAACAAAGG - Intergenic
1140156287 16:72430058-72430080 ATCCAGGTATTTGTGAAAGATGG + Intergenic
1140963395 16:79939996-79940018 CTCCTGTCATCTGGCAAACACGG - Intergenic
1141847203 16:86618953-86618975 AACCTTTCATTTTTGAATCATGG - Intergenic
1142318575 16:89366016-89366038 ATCATGTCTTTTGTGGAACATGG - Intronic
1203053731 16_KI270728v1_random:900428-900450 ATCCTGTCATTCGTGACAACAGG - Intergenic
1142971940 17:3618067-3618089 ATGCAGTGATTTGTGAATCATGG - Intronic
1143616986 17:8057770-8057792 ATTCATTCATTCGTGAAACAGGG - Intergenic
1144105383 17:11980141-11980163 ATCCTCTCATATGTGAAATTGGG + Intronic
1145256524 17:21326829-21326851 TTCATGGCATTTGTAAAACATGG + Intergenic
1145320084 17:21761124-21761146 TTCATGGCATTTGTAAAACATGG - Intergenic
1148050264 17:44766662-44766684 ATCCTGGCATTTGTAAAATGAGG + Intronic
1149165359 17:53745111-53745133 GTTCTGTCATTTGTCAGACAGGG - Intergenic
1149211238 17:54303983-54304005 ATCCTGCCATGTGGGAAATAGGG - Intergenic
1149328429 17:55556652-55556674 ATCATGTCATCTGCAAAACAGGG + Intergenic
1153266459 18:3275149-3275171 ATCCTGTCATTGCAGCAACATGG + Intronic
1153341472 18:3979067-3979089 ATGCTGTCATTTGCACAACATGG + Intronic
1153837248 18:8974971-8974993 ATCCTGTCATTTGCAAAACATGG + Intergenic
1154461016 18:14586248-14586270 ATCCTGTTATTTGCAAAGCATGG + Intergenic
1155375785 18:25155814-25155836 ATCCTGCCATTTGTACAACATGG + Intronic
1156125259 18:33897449-33897471 ATCATGTCTTTTGTGGGACATGG + Intronic
1156163557 18:34389848-34389870 ATTCTGTCATTTGTGACACATGG - Intergenic
1156434969 18:37117328-37117350 TTCATGTCATTTGTGGGACATGG + Intronic
1159073454 18:63652746-63652768 ATCCTGTCATTTATGACAACAGG + Intronic
1159163427 18:64673294-64673316 ATTCTGTCCTTCGTGCAACATGG + Intergenic
1159625367 18:70687081-70687103 ATCTTCTCATTTGTGAAATCTGG - Intergenic
1162610661 19:11748173-11748195 ATCCTGTCATTTGCAACAAATGG - Intergenic
1163083680 19:14963137-14963159 ATCCTGTCATTTGTGACAAGAGG + Intronic
1163122859 19:15228282-15228304 ATCCTGTGGATAGTGAAACATGG - Intronic
1164750578 19:30651547-30651569 AAACTATCATTTGTGAACCACGG - Intronic
1166789003 19:45386374-45386396 ATCCTGTGATTTGAGAATCTTGG + Intronic
1168090111 19:54077011-54077033 ATGCAGCCATGTGTGAAACAGGG - Intronic
926255907 2:11198574-11198596 ATCTTGACAGTTCTGAAACATGG + Exonic
927231000 2:20824031-20824053 TTCCTGGAATTTGTGATACAAGG - Intergenic
927767428 2:25824658-25824680 ATACTGTTATTTGTAAACCACGG - Intronic
928019992 2:27696766-27696788 ATTCTGTCATCTGTGAAGCAGGG + Intergenic
928634148 2:33225888-33225910 ATCCTGTCATTTGTGTAACATGG - Intronic
929012884 2:37463707-37463729 ATCATGTCATCTGTGAATAAAGG + Intergenic
929045389 2:37784111-37784133 ATTCTCTCATCTGTAAAACAGGG + Intergenic
929471818 2:42201659-42201681 AGCCTGTCATTTGCACAACATGG + Intronic
930288268 2:49461797-49461819 ATCCTGTCATTTGCACAACGTGG - Intergenic
930679836 2:54245188-54245210 ATCCTGTGATTCCTGCAACATGG - Intronic
933468649 2:82691188-82691210 ATCATGGCATTTGTAAAACTAGG + Intergenic
933514252 2:83280529-83280551 GTCCTGTCCTCTGGGAAACATGG - Intergenic
933804105 2:85985619-85985641 ATCCTGTCATTTGTGACAACAGG + Intergenic
934559488 2:95305400-95305422 ATGCTGTCATTGGGGAAACCAGG - Intronic
935847692 2:107184706-107184728 ATCCTGTTATTGGTGATACAGGG - Intergenic
936550881 2:113438368-113438390 TACCTGTCACCTGTGAAACAGGG + Intronic
936621657 2:114105764-114105786 ATTCTGTCATTTGTGACAACTGG - Intergenic
937170748 2:119865012-119865034 TTCCTGGCATTAGTGAAACTAGG + Intronic
937680416 2:124638260-124638282 ATACTGACATTGCTGAAACAAGG - Intronic
938185851 2:129231228-129231250 TTCTTCTCATTTGTGAAAGATGG + Intergenic
938990969 2:136629607-136629629 ATCCTGTCATTTATAAAACCGGG - Intergenic
939490956 2:142875697-142875719 ATGCTGTCATTTTTTGAACACGG - Intergenic
940059805 2:149552429-149552451 ATCATGTCCTTTGCGCAACATGG - Intergenic
940636124 2:156299263-156299285 CTTTTCTCATTTGTGAAACAAGG + Intergenic
941383153 2:164820854-164820876 TCCATGTCATTTCTGAAACAAGG - Intronic
941509509 2:166388136-166388158 ATGTTGTCATTTATGAAAAATGG + Intergenic
942774219 2:179561597-179561619 ATTTTGCCATTTGTAAAACATGG - Intronic
942781947 2:179654223-179654245 ATCCTGTCATGTTGGAGACACGG - Intronic
943495363 2:188613335-188613357 ATCTTGTCATTTGGGCAACATGG - Intergenic
943572473 2:189589996-189590018 ATCCTGTCATTTGAGCAATATGG - Intergenic
943874771 2:193051352-193051374 ATTCTGTCATTTGCAAAACATGG + Intergenic
943978511 2:194514423-194514445 ATCATGTCATTCGTGAGTCAAGG + Intergenic
944322613 2:198365749-198365771 ATCATGCCATCTGTGAAACTAGG - Intronic
944337091 2:198547592-198547614 ACATTGTCGTTTGTGAAACAAGG - Intronic
944822704 2:203446748-203446770 ATCTTGTGTTTTGTGAGACAGGG + Exonic
945118840 2:206437677-206437699 ATCCTGCCATTTGTGACAACAGG + Intergenic
945128130 2:206536161-206536183 ATCCTGGCATTTGCCAAATATGG - Intronic
945600310 2:211854642-211854664 ATACTGTCTTTTGTACAACACGG - Intronic
945939629 2:215935109-215935131 ATCCTGTCATTTGCACAACATGG - Intergenic
946799429 2:223395463-223395485 ATCATGTCATTTGTGAAGAAAGG + Intergenic
947584917 2:231349263-231349285 ATCCAGTCATTTGCAAAACATGG + Intronic
947921545 2:233879571-233879593 ATCCTTTCATTTGGAAAAAATGG - Intergenic
1169680284 20:8204358-8204380 ATCCTGTCATTTCTCATAGAAGG + Intronic
1170387314 20:15833387-15833409 AAACTGTCATGTGTTAAACAAGG - Intronic
1170708811 20:18770233-18770255 ATCGCGTCATTTGCAAAACATGG - Intergenic
1170767583 20:19303956-19303978 CTCCTGGTTTTTGTGAAACACGG - Intronic
1170897582 20:20430087-20430109 ATCCCCTCATCTGTGAAAGAGGG + Intronic
1172050805 20:32116214-32116236 ATCATCTCATTTTTGAAACAAGG + Intronic
1173485127 20:43435432-43435454 ATCCTGGCATTTGGGAATCTTGG - Intergenic
1173946053 20:46951822-46951844 GTTCCTTCATTTGTGAAACAGGG + Intronic
1174164865 20:48577456-48577478 AACCTGTCATTTGGGTCACATGG - Intergenic
1175065560 20:56284017-56284039 ATCCTGTCATTTTGACAACATGG + Intergenic
1176813486 21:13571592-13571614 ATCCTGTTATTTGCAAAGCATGG - Intergenic
1177081824 21:16649096-16649118 ATCCACTGATTTTTGAAACATGG + Intergenic
1177458554 21:21377990-21378012 ATCTTGTCATTTGCACAACATGG - Intronic
1177591558 21:23176297-23176319 GTCCTGTCATGTGCAAAACAAGG - Intergenic
1177936829 21:27358770-27358792 ATGCTGTCATGTGTAAAACAAGG + Intergenic
1178926535 21:36779999-36780021 ATCCATTCATTTGTGCAAAAAGG - Intronic
1180013948 21:45070839-45070861 CTCCTGACGTTTGAGAAACAAGG + Intergenic
1182991611 22:34773101-34773123 ATCCTGTTATTTGTGAACACAGG + Intergenic
1183684570 22:39354296-39354318 ATTCTGTCATTTGTAAAACGGGG - Intronic
1184505243 22:44896839-44896861 TTTCTGTCACTTATGAAACAGGG + Intronic
949107257 3:215246-215268 ATCCTGTCATTGTGGTAACATGG + Intronic
949211812 3:1512040-1512062 ATCCTGTGATTTGTACAACCAGG + Intergenic
949329490 3:2906022-2906044 ATCCTGTCATTTGTGACAAAAGG + Intronic
949366164 3:3283343-3283365 ATCCTGTCATTTGCCAAAAATGG - Intergenic
949633322 3:5953688-5953710 ATCCTGCCATTTGTGACAACAGG - Intergenic
949750290 3:7344607-7344629 AGCCTGTTATTCGTGCAACATGG + Intronic
950269346 3:11601171-11601193 GTTTTGTTATTTGTGAAACACGG - Intronic
951364890 3:21769296-21769318 ATCATGTCATCTGCAAAACAGGG - Intronic
953714144 3:45301740-45301762 TTCCTTTCATTCGTTAAACATGG - Intergenic
955125695 3:56109328-56109350 ATTATGTCTTTTGTGGAACATGG - Intronic
957482731 3:80819352-80819374 ATCATGTCCTTTGTGCAACATGG + Intergenic
957709833 3:83841679-83841701 ATCCTCTCACTTGGAAAACATGG + Intergenic
958173973 3:89971967-89971989 ATCATGTCCTTTGAGCAACATGG + Intergenic
958695135 3:97517900-97517922 ATTCTGTTACTTGTGCAACAGGG - Intronic
958745038 3:98123884-98123906 ATCCTGTAATTTTGGCAACATGG + Intergenic
960895178 3:122496707-122496729 CTCCTGTCTTTTTTGAGACAAGG + Intronic
961619310 3:128211069-128211091 ATGTTGTCATTTGCAAAACAGGG + Intronic
962341585 3:134589932-134589954 ATCATGTCTTTTCAGAAACATGG + Intergenic
963014927 3:140814014-140814036 ATCATGTCATCTGTGAACAAAGG - Intergenic
963416687 3:145004365-145004387 ATCCTCTCATTTGTGTGACATGG - Intergenic
964491236 3:157238675-157238697 ATCCTGCCATTTGCACAACATGG - Intergenic
964558701 3:157968876-157968898 ATCCTGATATTTGTGAAACTGGG - Intergenic
965016384 3:163163365-163163387 ATGCAGTCATTAGAGAAACATGG - Intergenic
965342612 3:167508738-167508760 ATGCTTTCATTTGTCATACATGG + Intronic
966205174 3:177398873-177398895 AATCTGTCATATGGGAAACATGG + Intergenic
967894287 3:194384109-194384131 ATCCTGTCATGTTTGAAAGCGGG - Intergenic
968078847 3:195833068-195833090 ATTTTCTCATTTGTAAAACAGGG - Intergenic
969133203 4:5007384-5007406 GTCCTGTCATTTGTGACAGGAGG + Intergenic
970764358 4:19529582-19529604 ATCCTGTTATTTGTGCAACATGG + Intergenic
971439058 4:26660285-26660307 ATACTGTCTTTGGTGAAACTAGG + Intronic
973215792 4:47667814-47667836 TTCCTGTGATTTGTGAAGGAGGG + Intronic
973887001 4:55333042-55333064 ATCATGTCATCTGTGAATAAGGG - Intergenic
973933854 4:55821698-55821720 ATTCTGTCATGTAAGAAACAAGG + Intergenic
974337152 4:60563972-60563994 ATCTAGTCATTTGTACAACATGG - Intergenic
975199946 4:71575231-71575253 ATCATGTCATCTTTCAAACAGGG + Intergenic
975451589 4:74533670-74533692 ATAATGTCATTTTTAAAACACGG + Intergenic
975994582 4:80299566-80299588 ACCCTGTCATTTGGACAACATGG - Intronic
976595039 4:86887550-86887572 GTGCTGTCGTTTGTGACACAAGG + Exonic
977586089 4:98777111-98777133 ATAATGTAATTTGTGAACCATGG + Intergenic
977621360 4:99141233-99141255 AAGGTGTCATTTGTTAAACATGG + Intronic
977712468 4:100143567-100143589 ATTCTGTCATCTGAGATACAAGG - Intergenic
978094582 4:104760608-104760630 TTACTGTCATTTTTGAAACTTGG + Intergenic
978946352 4:114502797-114502819 ACCCTGTCATTTGTGACAAAAGG - Intergenic
979757353 4:124358415-124358437 ATCTTGTCATTTGGAAGACATGG + Intergenic
980005722 4:127540263-127540285 GTCCTGTCATTTGTGACAACTGG - Intergenic
981032687 4:140141371-140141393 ATCCAGTCATCTGTGTAACATGG - Intronic
981571207 4:146152417-146152439 ATCCTGTCATCCTTGACACATGG + Intergenic
982457669 4:155629387-155629409 ATGCTGTCATTTGTACAACAAGG + Intergenic
983534533 4:168843220-168843242 ATACTCTAATTTGGGAAACATGG + Intronic
984068287 4:175078177-175078199 ATCTTGTCAATTGCAAAACATGG - Intergenic
985206075 4:187538546-187538568 AGACTGTCCTTTCTGAAACAAGG + Intergenic
985345003 4:188994836-188994858 CTCCTGTCATATGTGATACATGG - Intergenic
987398480 5:17449287-17449309 ACTCTGTAATCTGTGAAACATGG - Intergenic
987403795 5:17504394-17504416 ATCTTGTCATTTGTGACACATGG - Intergenic
987404227 5:17508743-17508765 ATCTTGTCATTTGTGACACATGG - Intergenic
987411262 5:17617139-17617161 ATCTTGTCATTTGTGACACATGG - Intergenic
987411831 5:17622456-17622478 ATCTTGTCATTTGTGACACATGG - Intergenic
987490298 5:18571873-18571895 ATCCTGTCATTTGTGGCAAGTGG + Intergenic
987916130 5:24217085-24217107 ATCCTGCCATTTGTGACAACAGG - Intergenic
988440120 5:31224426-31224448 GTTCTGTCATTTGTGAAATGGGG - Intronic
989233952 5:39122397-39122419 ATTCTGTCTTTTGTTAGACATGG - Exonic
991289161 5:65015248-65015270 ATCAAGTCATTTTTGAAACATGG + Intronic
991431280 5:66550071-66550093 GTCCTGTCATTTAAGATACAAGG + Intergenic
991555042 5:67886432-67886454 ATTCTGCCATTTGTGAAAGAGGG + Intergenic
991662439 5:68963623-68963645 ACACTGTCATTTGTGTAAGAAGG + Intergenic
992792585 5:80226850-80226872 ATCCTCTTACTTGTGAAAAATGG - Intronic
992932090 5:81658714-81658736 ATCCTGTCATTTTGACAACATGG - Intronic
992935022 5:81694010-81694032 ATCCTGTCATTTCAACAACATGG + Intronic
993182225 5:84568287-84568309 ATGCTGTCATTTGTGAACTGAGG - Intergenic
993247683 5:85471651-85471673 ATCATGTCCTTTGCAAAACATGG + Intergenic
993349136 5:86824935-86824957 ACCCTGTCATTTATAATACAGGG + Intergenic
994425858 5:99586439-99586461 ATTCATTCATTTGTGAGACAGGG + Intergenic
994427616 5:99612684-99612706 ATCTTTTCATTTATGAATCATGG + Intergenic
994579633 5:101623974-101623996 AGCATGTCATTTGTGAATAAAGG + Intergenic
994970185 5:106727694-106727716 TGCGTGTCATTTATGAAACAGGG - Intergenic
995059043 5:107794175-107794197 ATCATGTCCTTTGCAAAACATGG + Intergenic
995906582 5:117131318-117131340 AGCCTGTCTTTTATGTAACAAGG + Intergenic
996907234 5:128615217-128615239 ATCCTGGAACTTGTGAAACTGGG + Intronic
998656117 5:144181617-144181639 ATTCTGCCATTTGTGCAACATGG + Intronic
999192840 5:149761660-149761682 ATTCTGTCATTTGTGTAGCATGG + Intronic
999720932 5:154398734-154398756 ATTCTCTCATTTGTGGAACAGGG - Intronic
1000367875 5:160507773-160507795 ATGCTTTCATTTGTAAAAGAAGG - Intergenic
1001178896 5:169499786-169499808 ATCATGTCCTTTGTGCAACATGG - Intergenic
1002824234 6:758284-758306 ATCCACTAATATGTGAAACAAGG - Intergenic
1004784442 6:18950951-18950973 ATCCTGTCATTTGTGCAACATGG + Intergenic
1005138032 6:22593815-22593837 ATCTGCTCATTTGTGAAACCTGG + Intergenic
1005178551 6:23076341-23076363 ATTCTGTCATTTGTGCAACATGG + Intergenic
1005215784 6:23526608-23526630 ATTTTCTCATCTGTGAAACAAGG - Intergenic
1007010438 6:38411889-38411911 ATTGTGTCATTTGGGCAACAGGG + Intronic
1007022571 6:38536656-38536678 ATCCTATCATTTGCACAACATGG + Intronic
1007552115 6:42738114-42738136 ATCCTGTCATTTGCAACAAATGG + Intergenic
1007943943 6:45808406-45808428 AGCCTGTCATTAATGAGACAGGG - Intergenic
1008425428 6:51350966-51350988 ATTTTGTCATTTGTAAAACAAGG - Intergenic
1010608543 6:77922944-77922966 ATCCTGTCACTGGTGAACAAGGG - Intronic
1010676172 6:78746177-78746199 ATCCTGTCATATCTACAACATGG + Intergenic
1010939152 6:81895610-81895632 ATTCTGTTATTAGTGAATCAGGG + Intergenic
1011326869 6:86158095-86158117 ATCATGTCCTTTGTATAACATGG + Intergenic
1012002997 6:93677792-93677814 TTCCTGTCATTTCTGAGTCATGG + Intergenic
1013563067 6:111326076-111326098 ATCCCGTCATTTGCAAAACATGG - Intronic
1013568546 6:111395629-111395651 ATCATGTCACCTGTGAAAAAGGG + Intronic
1013943930 6:115699534-115699556 ATCCTGTCACTTGCTAAAAATGG - Intergenic
1014012777 6:116495321-116495343 ATCCTGTCATTTGCAAAACATGG - Intronic
1014272799 6:119351743-119351765 ACCCTGTCATTTAAGAAATACGG - Intergenic
1014607055 6:123488908-123488930 ATTCTTTCATCTGTAAAACATGG + Intronic
1015327861 6:131944431-131944453 ATCCTGTCATTTGTGACAACAGG + Intergenic
1016028399 6:139312514-139312536 ATACTGTCATTTTTGAGGCAAGG - Intergenic
1016271821 6:142299267-142299289 ATTCTGTCATTTGTGACACGTGG - Intergenic
1016285820 6:142471908-142471930 ATCATGTCATTTGCAAACCAGGG - Intergenic
1016633836 6:146264842-146264864 ATCATGTCTTTTGTGCAACATGG - Intronic
1016911442 6:149203006-149203028 ATTCTGACATTTGTTAAAAATGG - Intergenic
1017187375 6:151615704-151615726 GTCCTGTCATTTCCTAAACAAGG - Intronic
1018311506 6:162514401-162514423 AGCCTGTCATTTATCATACAGGG - Intronic
1018461859 6:164006191-164006213 ATCATGGCCTTTGTGCAACATGG + Intergenic
1018573970 6:165238600-165238622 ATCATGTCCTTTGTGCAGCATGG - Intergenic
1018693013 6:166364167-166364189 ATTCTGTCACTTTTGAGACAGGG - Intergenic
1020411735 7:7899878-7899900 ATACTGTCCTTTATGAAACTGGG - Intronic
1020887388 7:13835002-13835024 ATCCTTCCATTTGTGATAAAAGG - Intergenic
1021208872 7:17819251-17819273 ATCCATTCATTTATGGAACAGGG + Intronic
1022030213 7:26485953-26485975 ATACTATCATCTGTGAAATATGG + Intergenic
1022246502 7:28565166-28565188 ATTCTCTCATTTATGATACATGG - Intronic
1023132762 7:37019138-37019160 ATTTTCTCATCTGTGAAACAGGG - Intronic
1024088071 7:45913334-45913356 GTGGTGTCATTTCTGAAACAAGG - Intronic
1024520092 7:50298061-50298083 ACACTGTCATTTCTGCAACAGGG - Intergenic
1024753038 7:52491329-52491351 AACCTCTCATTTGACAAACAAGG - Intergenic
1024908429 7:54416694-54416716 ATCCTATTATTTGAGCAACAGGG + Intergenic
1025854848 7:65267911-65267933 AACCTGTCATTGGTGACAAAAGG + Intergenic
1027649894 7:80853451-80853473 ATCCTGTCATTTGCACAACATGG + Intronic
1028047334 7:86139144-86139166 TTCCTATCATTTATGTAACATGG + Intergenic
1028341243 7:89722407-89722429 ATCTGGTCATTTGTCAAACCTGG - Intergenic
1029031967 7:97478074-97478096 GACCTGTCACTTGAGAAACAGGG - Intergenic
1030407646 7:109134222-109134244 ATCATGTCCTTTGCGCAACATGG + Intergenic
1030429275 7:109421417-109421439 AGCATGTCATTGGTGAAAGAAGG - Intergenic
1031180138 7:118403728-118403750 ACCCTGTCATTTGTGCAACATGG - Intergenic
1032661641 7:133990423-133990445 ATCCTGTCATTCGAGCAACATGG - Intronic
1033084314 7:138328291-138328313 ATTCTGGGATTTGTGATACAAGG - Intergenic
1033387994 7:140897693-140897715 ATCCTGGCATGGATGAAACATGG - Intronic
1033813724 7:145047770-145047792 ACCCTGTCATGTGCAAAACATGG - Intergenic
1034460299 7:151194284-151194306 ATTCTGTCGTATGTCAAACAGGG + Exonic
1035385096 7:158466486-158466508 ATCCTGTCATTTTCAAAACATGG - Intronic
1036011788 8:4733502-4733524 ATCCTCTCAATGGTGCAACAAGG + Intronic
1036481404 8:9142815-9142837 ATCCTGTCATTTGTGCCAACGGG - Intronic
1037382101 8:18296665-18296687 ATCGTGTCCTTTGAGCAACATGG - Intergenic
1038216091 8:25562861-25562883 ATCCTGTCATTTGGGAAGGATGG + Intergenic
1039656558 8:39415244-39415266 ATCCTGTAATGTGTAAAACATGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1042197153 8:66240840-66240862 ACCCTTTCATTTCTAAAACAGGG + Intergenic
1042695692 8:71552789-71552811 ATCCTGGCCTCTGTGAAATAAGG - Intronic
1042974360 8:74449718-74449740 ATCATGTCATCTGTGAATAAGGG + Intronic
1043234406 8:77843713-77843735 ATTCTCTCATTTGATAAACAGGG - Intergenic
1044080727 8:87879718-87879740 ATGCTTTCTTTGGTGAAACAGGG + Intergenic
1045573080 8:103389990-103390012 ATCCTGTCATGTGCAACACATGG + Intergenic
1045652576 8:104354862-104354884 ATTCTTTCATTTTAGAAACAAGG + Exonic
1045906366 8:107350169-107350191 TTGCTGTCATTTAGGAAACATGG - Intronic
1046368142 8:113263803-113263825 ATCTTGTCCTTTGTGATACCAGG + Intronic
1046640536 8:116725117-116725139 ATCCTGTCATTGCTACAACATGG + Intronic
1048107132 8:131423562-131423584 TTCTTTTCATTTTTGAAACAGGG + Intergenic
1048267457 8:133000043-133000065 TTGCTGTCACTTGTAAAACAGGG - Intronic
1048707023 8:137165202-137165224 ATCCTGTCATTCCTGAAAGAAGG - Intergenic
1049727186 8:144153172-144153194 TTCCTGTCATTTGCGAGAAATGG - Intronic
1049834489 8:144725847-144725869 ATCCTGTCATATATGTAACAAGG + Intronic
1049902054 9:178448-178470 TACCTGTCACCTGTGAAACAGGG - Intronic
1050984836 9:12069465-12069487 TTACTATCATCTGTGAAACATGG - Intergenic
1053049236 9:34945066-34945088 ATTCTGTCATTTGGAAGACATGG - Intergenic
1053482393 9:38425135-38425157 CTCTTGTCATCTGTGAAACTGGG + Intergenic
1056567869 9:87790769-87790791 ATCCTGTCATTTGCGTGAAATGG + Intergenic
1057178449 9:93016132-93016154 ATCCTGTCACCTGTGAGACTGGG + Intronic
1057264997 9:93610949-93610971 ATCTTCTGATCTGTGAAACAAGG - Intronic
1057341295 9:94204160-94204182 AGGCTGTCATTTGTGACACGTGG + Intergenic
1057977438 9:99621109-99621131 ATCCTGTCGTTCCTGGAACATGG + Intergenic
1057980405 9:99655848-99655870 ATCATGTCATTTGTGCAACATGG + Intergenic
1058276759 9:103052012-103052034 ATCTTGTCATTTGTGAAACATGG + Intergenic
1058406461 9:104681052-104681074 ATCCTGTCATTTGCACAACATGG + Intergenic
1059461585 9:114434223-114434245 CTGCTGTCATCTATGAAACACGG - Intronic
1060003028 9:119975647-119975669 TGCCAGTCATTAGTGAAACATGG - Intergenic
1062369148 9:136228081-136228103 CTCCTGGCATTTCTGTAACAGGG + Intronic
1062681298 9:137782978-137783000 AACCTGGCACTTGAGAAACAGGG - Intronic
1185732179 X:2470080-2470102 ATCCTGCCATTTGCGCAACATGG + Intronic
1186927159 X:14346789-14346811 ATCATGTCATTTGTAAAACATGG - Intergenic
1187178749 X:16922168-16922190 ATCCTGTCATTGCAGCAACATGG + Intergenic
1187724562 X:22189086-22189108 ATCCTGTCATTTGCAACACATGG - Intronic
1188419143 X:29975187-29975209 ATCCTGTCATTTGAACAACATGG - Intergenic
1188448092 X:30278246-30278268 ATGTTTTCATTTGTAAAACAAGG + Intergenic
1188920081 X:35963012-35963034 ATCTTGTCATTTGCGAAACATGG + Intronic
1190459286 X:50655422-50655444 ATCCTGTCATTTGTACAACATGG - Intronic
1190512560 X:51188625-51188647 ATCCTGTCATTTGTGGCAAATGG + Intergenic
1191760729 X:64645560-64645582 ATCCTGTCACTTGCAAGACATGG + Intergenic
1192110816 X:68362207-68362229 ATCCTGACATTTGCAACACAGGG + Intronic
1192319148 X:70075374-70075396 ATCCATTCACTTGTGAAACTGGG + Intergenic
1192874529 X:75214337-75214359 ATCCTGCCATTTGTGAAATATGG + Intergenic
1193143272 X:78051926-78051948 ATCCTGTCATTTGAGAAAGATGG - Intergenic
1193335853 X:80288023-80288045 ATCCTGTCATTTGCTCAACATGG + Intergenic
1193787924 X:85783377-85783399 ATCATGTCCTTTGCCAAACATGG + Intergenic
1193848849 X:86510214-86510236 TTCATGTCATTTGTGATTCAAGG - Intronic
1193934777 X:87604044-87604066 ATCCTGCCGCTTATGAAACAAGG - Intronic
1194166110 X:90519182-90519204 ATCCAGTCATTTGTGAAACATGG + Intergenic
1195157606 X:102139908-102139930 ATCTTGTCATTTGTAAAATAAGG - Intergenic
1196274396 X:113750093-113750115 GTGCTTTCATTTGTGAACCAAGG + Intergenic
1197079151 X:122391306-122391328 ATTCTGTCATGTGTGCCACATGG + Intergenic
1197163554 X:123350636-123350658 ATCCACTCATCTGTGAAACTGGG - Intronic
1197260954 X:124317340-124317362 ATCATGTCATCTGTGAACAACGG - Intronic
1198328662 X:135600496-135600518 ATCATGTCATTGTAGAAACATGG - Intergenic
1199741947 X:150743938-150743960 TTCCTGACATTTCTGAAAAATGG + Intronic
1199916480 X:152347173-152347195 ATCCTGTCATTTGCAAAACATGG + Intronic
1200512380 Y:4096947-4096969 ATCCAGTCATTTGTGAAACATGG + Intergenic
1200665604 Y:6018338-6018360 ATTCTGTGTTTTGTGAAACATGG - Intergenic