ID: 1118208044

View in Genome Browser
Species Human (GRCh38)
Location 14:63741569-63741591
Sequence GCAAAGATATTGAAGCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118208040_1118208044 -2 Left 1118208040 14:63741548-63741570 CCATTCTCATACAACTCCCCTGC No data
Right 1118208044 14:63741569-63741591 GCAAAGATATTGAAGCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118208044 Original CRISPR GCAAAGATATTGAAGCCTGA AGG Intergenic
No off target data available for this crispr