ID: 1118210048

View in Genome Browser
Species Human (GRCh38)
Location 14:63757551-63757573
Sequence CTGTGTAAGCAACAGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118210048_1118210051 27 Left 1118210048 14:63757551-63757573 CCCTCTTTCTGTTGCTTACACAG No data
Right 1118210051 14:63757601-63757623 AAATTCTAGACAACAGCTTAAGG No data
1118210048_1118210052 28 Left 1118210048 14:63757551-63757573 CCCTCTTTCTGTTGCTTACACAG No data
Right 1118210052 14:63757602-63757624 AATTCTAGACAACAGCTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118210048 Original CRISPR CTGTGTAAGCAACAGAAAGA GGG (reversed) Intergenic
No off target data available for this crispr