ID: 1118214219

View in Genome Browser
Species Human (GRCh38)
Location 14:63793201-63793223
Sequence GTTGACACACACAGCCACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118214217_1118214219 -1 Left 1118214217 14:63793179-63793201 CCAGGAGGAGGAATTTCCTGATG No data
Right 1118214219 14:63793201-63793223 GTTGACACACACAGCCACCTTGG No data
1118214215_1118214219 10 Left 1118214215 14:63793168-63793190 CCTCTTGGCTCCCAGGAGGAGGA No data
Right 1118214219 14:63793201-63793223 GTTGACACACACAGCCACCTTGG No data
1118214216_1118214219 0 Left 1118214216 14:63793178-63793200 CCCAGGAGGAGGAATTTCCTGAT No data
Right 1118214219 14:63793201-63793223 GTTGACACACACAGCCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118214219 Original CRISPR GTTGACACACACAGCCACCT TGG Intergenic
No off target data available for this crispr