ID: 1118220698

View in Genome Browser
Species Human (GRCh38)
Location 14:63852891-63852913
Sequence CGCTCTACACTGGCCGCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118220683_1118220698 28 Left 1118220683 14:63852840-63852862 CCGCCCCGGGCTGCGGCGGGGCC 0: 1
1: 1
2: 6
3: 57
4: 429
Right 1118220698 14:63852891-63852913 CGCTCTACACTGGCCGCCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1118220695_1118220698 -7 Left 1118220695 14:63852875-63852897 CCGGCGCTGGCGGGCGCGCTCTA 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1118220698 14:63852891-63852913 CGCTCTACACTGGCCGCCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1118220693_1118220698 -5 Left 1118220693 14:63852873-63852895 CCCCGGCGCTGGCGGGCGCGCTC 0: 1
1: 0
2: 2
3: 17
4: 160
Right 1118220698 14:63852891-63852913 CGCTCTACACTGGCCGCCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1118220686_1118220698 23 Left 1118220686 14:63852845-63852867 CCGGGCTGCGGCGGGGCCTGCTG 0: 1
1: 1
2: 4
3: 41
4: 383
Right 1118220698 14:63852891-63852913 CGCTCTACACTGGCCGCCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1118220694_1118220698 -6 Left 1118220694 14:63852874-63852896 CCCGGCGCTGGCGGGCGCGCTCT 0: 1
1: 0
2: 0
3: 16
4: 137
Right 1118220698 14:63852891-63852913 CGCTCTACACTGGCCGCCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1118220688_1118220698 7 Left 1118220688 14:63852861-63852883 CCTGCTGCTCCGCCCCGGCGCTG 0: 1
1: 0
2: 0
3: 29
4: 311
Right 1118220698 14:63852891-63852913 CGCTCTACACTGGCCGCCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1118220692_1118220698 -2 Left 1118220692 14:63852870-63852892 CCGCCCCGGCGCTGGCGGGCGCG 0: 1
1: 0
2: 1
3: 20
4: 190
Right 1118220698 14:63852891-63852913 CGCTCTACACTGGCCGCCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1118220682_1118220698 29 Left 1118220682 14:63852839-63852861 CCCGCCCCGGGCTGCGGCGGGGC 0: 1
1: 0
2: 7
3: 65
4: 513
Right 1118220698 14:63852891-63852913 CGCTCTACACTGGCCGCCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1118220684_1118220698 25 Left 1118220684 14:63852843-63852865 CCCCGGGCTGCGGCGGGGCCTGC 0: 1
1: 0
2: 2
3: 42
4: 381
Right 1118220698 14:63852891-63852913 CGCTCTACACTGGCCGCCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1118220685_1118220698 24 Left 1118220685 14:63852844-63852866 CCCGGGCTGCGGCGGGGCCTGCT 0: 1
1: 0
2: 1
3: 46
4: 475
Right 1118220698 14:63852891-63852913 CGCTCTACACTGGCCGCCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118220698 Original CRISPR CGCTCTACACTGGCCGCCGA GGG Intergenic
915141762 1:153772453-153772475 CCGTCTACACTGGACGCCGAGGG - Intronic
920766830 1:208841642-208841664 CGCTCGACACTGCCAGCGGAAGG - Intergenic
922675012 1:227544474-227544496 CACCAAACACTGGCCGCCGATGG - Intergenic
1077277936 11:1725311-1725333 CGCTCTACACTCGCCCCCACTGG - Intergenic
1090982950 11:131739524-131739546 CACCCCACACTGGCCGCCGTTGG + Intronic
1093497532 12:19775462-19775484 CCCGCTCCTCTGGCCGCCGAAGG + Intergenic
1113933614 13:113981630-113981652 CCCACTACACTGGCCGTCCAGGG + Intronic
1118220698 14:63852891-63852913 CGCTCTACACTGGCCGCCGAGGG + Intergenic
1118837137 14:69485240-69485262 CACTCTACACTGGCTCCCGCAGG + Intronic
1129332576 15:74835423-74835445 TGCTCCACACTGCCCCCCGATGG + Intergenic
1132551678 16:556297-556319 CGCTCCCCACTGGCCGGCCAGGG + Intergenic
1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG + Intronic
1148780036 17:50116142-50116164 CACCCCACACTGGCAGCCGAAGG - Intronic
1152228560 17:79103657-79103679 CCCTCTACCCTGGGCTCCGAGGG - Intronic
1162561846 19:11421829-11421851 GGCTCTACCCTGGCCGCAGGAGG - Exonic
1168701313 19:58441124-58441146 CGCTCTCCACTCGCTGCCAAGGG - Intergenic
926240433 2:11081008-11081030 CCCTCTGCCCTGGCCGCCCAGGG - Intergenic
1173051306 20:39564612-39564634 AGCTCTACACTGGGCACCCATGG + Intergenic
1173843587 20:46174530-46174552 CGCTCTACGCCGGCCACCGCGGG - Exonic
1175824168 20:61927682-61927704 GGCTCTGCACTGGCCCCTGAGGG - Intronic
1181273816 22:21676193-21676215 CGCTCCACCCTGGTGGCCGAGGG + Intronic
964271382 3:154959871-154959893 CGCTGTACACTGGCCTCACAAGG + Intergenic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985571148 5:646020-646042 CTGTCCACACAGGCCGCCGATGG - Intronic
998340931 5:141417598-141417620 TGCTCTGCACTGGCCGACGGCGG - Intronic
1008816938 6:55579355-55579377 CGCACTACACTGAGCGCCCAGGG + Intergenic
1008868802 6:56247535-56247557 AGCTCTGCACTGGCCGCTGCAGG - Exonic
1018957526 6:168420101-168420123 CCCTCTACCCTGGCCCCTGAAGG + Intergenic
1035450300 7:158973571-158973593 CGCTCTTCAGCGGCCTCCGAAGG + Intergenic
1044913868 8:97091131-97091153 CGCTCTAGACTGGGCGCTGTTGG + Intronic
1062218673 9:135402882-135402904 CCCTCAACACCGGCCACCGAGGG + Intergenic
1062346804 9:136118749-136118771 CGCCCTACGGTGGCCGTCGAGGG - Exonic
1189054599 X:37685822-37685844 CGCTCTGCGCAGCCCGCCGAGGG - Exonic