ID: 1118224954

View in Genome Browser
Species Human (GRCh38)
Location 14:63890141-63890163
Sequence GCTTCGTCCTGCTGTGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118224952_1118224954 4 Left 1118224952 14:63890114-63890136 CCAGTGGTGTGATCTTGGCTTAC 0: 5
1: 57
2: 285
3: 749
4: 1402
Right 1118224954 14:63890141-63890163 GCTTCGTCCTGCTGTGCTCTGGG 0: 1
1: 0
2: 0
3: 20
4: 186
1118224949_1118224954 21 Left 1118224949 14:63890097-63890119 CCTCGGCTGTATGGAGTCCAGTG 0: 1
1: 0
2: 11
3: 532
4: 630
Right 1118224954 14:63890141-63890163 GCTTCGTCCTGCTGTGCTCTGGG 0: 1
1: 0
2: 0
3: 20
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118224954 Original CRISPR GCTTCGTCCTGCTGTGCTCT GGG Intronic
900704691 1:4073045-4073067 GCTCTGTCCTGCCGTGCTCTGGG - Intergenic
904436040 1:30496831-30496853 ACTTCTTCCTGCTTTACTCTTGG - Intergenic
904799996 1:33085900-33085922 ACTTCTTCCTGCGGTGCCCTGGG + Intronic
909234691 1:73137714-73137736 GCTTTGTATTTCTGTGCTCTCGG + Intergenic
910928457 1:92419706-92419728 GCTTCATAGTGCTGTCCTCTTGG + Intergenic
912337513 1:108876797-108876819 GCTTGGTCCTCCTCTGCTCCGGG - Exonic
915347911 1:155207429-155207451 GCTTCGTCCCCCTGGGCTCCTGG - Intronic
915718848 1:157968775-157968797 TCTTCTTCCTGCTGTTCCCTTGG - Intergenic
919513139 1:198491156-198491178 TCTTCTTCCTGCTGCTCTCTTGG - Intergenic
923596914 1:235367555-235367577 GCGTCACCCTGCAGTGCTCTTGG + Intronic
924192839 1:241573202-241573224 GTTTCGACCTGCTGTGCTCAAGG + Intronic
924219398 1:241856955-241856977 GCTTCGACCTCCTGGGCTCTGGG - Intronic
1063286826 10:4697553-4697575 GCTTCAACCTCCTGGGCTCTAGG - Intergenic
1064563497 10:16616285-16616307 GCTTCTTCCTGCTTTAGTCTTGG - Intronic
1067250411 10:44581735-44581757 GCTTGCTCCAGATGTGCTCTTGG + Intergenic
1067757167 10:49013880-49013902 GCTTCCTCATGATGTTCTCTGGG + Intergenic
1069373107 10:67767663-67767685 GCGTCATTCTGCTGTGATCTTGG + Intergenic
1071838876 10:89448044-89448066 GCTTCGTCCTGGTTTAGTCTGGG - Intronic
1073504572 10:103974088-103974110 CTTTCGTTTTGCTGTGCTCTTGG + Intronic
1074988959 10:118685168-118685190 GCTACTTCCTGCGATGCTCTAGG - Exonic
1075835374 10:125448421-125448443 CCTTCGTCCTCCTGTTCTCTAGG + Intergenic
1076014979 10:127020482-127020504 GCTTTGACCTCCTGTGCTCCAGG - Intronic
1076522699 10:131090905-131090927 GCTGCCTCCTGCTGAGCTCCTGG - Intergenic
1077406961 11:2386975-2386997 GCAGCTTCTTGCTGTGCTCTGGG - Intronic
1079791412 11:24744705-24744727 ACTTAGTCCTGCTCTGATCTTGG + Intronic
1081766909 11:45617689-45617711 GCTTAGACATGCTGTGCACTGGG - Intergenic
1084351494 11:68603196-68603218 GCTTCTGCCTGCTGTTGTCTGGG - Intronic
1085301223 11:75459925-75459947 GCTTCAGCCTGCTGTCATCTGGG + Intronic
1085403418 11:76247813-76247835 GCTGCGTCCTCCTGCTCTCTGGG + Intergenic
1087623793 11:100572536-100572558 GCTTCGACCTCCTGGGCTCAGGG - Intergenic
1088918394 11:114244170-114244192 GGTTAGTCCAGCCGTGCTCTTGG + Intronic
1089498589 11:118919991-118920013 CCTTCCTCCCACTGTGCTCTGGG + Intronic
1089579804 11:119474615-119474637 CCTCCGTCCTTCAGTGCTCTGGG + Intergenic
1094157355 12:27351069-27351091 GCCTCGTCCTCCTATGCTCAAGG + Intronic
1097979294 12:65720465-65720487 GCTTCGACCTCCTGGGCTCAAGG - Intergenic
1098086614 12:66851396-66851418 GCTTTGGGCTGCTGAGCTCTTGG - Intergenic
1098269525 12:68756331-68756353 GCCTCAGCCTGCTGTGGTCTTGG - Intronic
1099534959 12:83831740-83831762 GCTTCGTCCTGGTTTAGTCTTGG + Intergenic
1100791778 12:98138083-98138105 CCTTCCTCCTTCTGTGCACTTGG + Intergenic
1101519434 12:105467861-105467883 GCTTCCTCCGGCCCTGCTCTTGG + Intergenic
1101642786 12:106600749-106600771 GCTTCGTCATGCTGGCCTCCTGG + Intronic
1102167280 12:110816679-110816701 GCTTCTTCCTGGGATGCTCTGGG + Intergenic
1103167807 12:118785176-118785198 GCTTTCTTCAGCTGTGCTCTGGG - Intergenic
1103774415 12:123355698-123355720 GCTTCGACCTGCTAGGCTCAAGG - Intronic
1103930878 12:124450154-124450176 GGTTTGTCCGGGTGTGCTCTGGG - Intronic
1104735223 12:131132278-131132300 GCAGTGTCCTGGTGTGCTCTGGG + Intronic
1104964391 12:132502482-132502504 GGTCAGTCCTGCTGTGCACTCGG - Intronic
1105455581 13:20538283-20538305 GCTTCGACCTCCTGGGCTCAAGG - Intergenic
1106084712 13:26531083-26531105 ACTTCATCCTGCTGTGCTTTGGG + Intergenic
1107804543 13:44141778-44141800 GCCTCGTCCCGCTCTGCTCAAGG - Intergenic
1108179021 13:47822585-47822607 TCTTGGTCCTGGTGTTCTCTCGG + Intergenic
1108957742 13:56182507-56182529 GCTTAAGCCTGCTGAGCTCTTGG + Intergenic
1111009625 13:82294070-82294092 GCCTCGTCCTCCTGGGCTCAAGG + Intergenic
1111021321 13:82456195-82456217 GCATCGTCCTCCTGAGCTCAAGG - Intergenic
1113764350 13:112871540-112871562 GGGGCGTCCTGCCGTGCTCTGGG + Intronic
1113853842 13:113433258-113433280 GCATTTTCCTGCTGTGCCCTGGG - Intronic
1114345693 14:21792321-21792343 GGTTCTTCCTTATGTGCTCTAGG - Intergenic
1115717124 14:36118415-36118437 GCTTGGTCCTGGTGTGCCCGGGG - Intergenic
1116137859 14:40951615-40951637 ACTTCTTCCTGCTTTACTCTTGG + Intergenic
1116239513 14:42323188-42323210 GCTTCTTCTTGCTGTGCTGCTGG - Intergenic
1118071347 14:62249687-62249709 GCTTCATCCCGCTGAGCTCCAGG - Intergenic
1118224954 14:63890141-63890163 GCTTCGTCCTGCTGTGCTCTGGG + Intronic
1122658955 14:103281688-103281710 GCTGCTTTCTGCTGTGCTCTGGG + Intergenic
1123087105 14:105721744-105721766 GCTCCGTCCAGCTGTGCAGTGGG - Intergenic
1123799301 15:23803901-23803923 CCTTCCTCCTGCTGGGCTCCTGG - Intergenic
1125449928 15:39797547-39797569 GCTGGGTACTGCTGAGCTCTTGG - Intergenic
1125561017 15:40633621-40633643 GCTTCAACCTCCTGTGCTCAAGG + Intronic
1126420561 15:48467985-48468007 GCTTCCTGCTGCTGTTCTCTGGG - Exonic
1129072078 15:72960039-72960061 CCTTGGTCCTGGGGTGCTCTTGG - Intergenic
1132207173 15:99994089-99994111 GCTTCCTTCTGCTTTGCTTTTGG - Intronic
1132593153 16:735217-735239 GCTGCGTCCAGCTGTGCCCTAGG - Intronic
1136127042 16:28191546-28191568 GATTGGACTTGCTGTGCTCTGGG - Intronic
1138387954 16:56648948-56648970 GCTCCTGCCTGCTGAGCTCTCGG - Intronic
1141148837 16:81550558-81550580 GCTTCCACCCTCTGTGCTCTAGG + Intronic
1141425203 16:83940372-83940394 TCCTTGTCCTGCTGGGCTCTGGG + Intronic
1141846749 16:86614952-86614974 GCTTCCTCCTCCTGGGTTCTGGG - Intergenic
1141944252 16:87298650-87298672 GCTTCATCCTCCAGTGCTCTTGG + Intronic
1143029475 17:3959889-3959911 TCTTCGTCCGACTGTGCTATGGG + Intronic
1144341083 17:14310744-14310766 CCTTCCTCCTGATGTGCTGTCGG + Intronic
1144649710 17:16999749-16999771 GCTTGGTTCTGCTGGGCTCTGGG - Intergenic
1146039622 17:29438604-29438626 GCCTCGACCTCCTGAGCTCTGGG - Intronic
1146092771 17:29898565-29898587 GCTTCTTCCTGGTGTAGTCTTGG - Intronic
1147567648 17:41547527-41547549 GCTTCCCACTGCTCTGCTCTGGG + Intergenic
1147627790 17:41910984-41911006 GCTTCCTTCTGCTGGCCTCTGGG - Intronic
1147905919 17:43822998-43823020 GCTTAGTCCTGCTGGGAACTTGG - Intronic
1148160100 17:45444799-45444821 GCTTTGTCCTCCTCTGATCTGGG + Intronic
1148191347 17:45680969-45680991 GGTGCCTCCTGCTGAGCTCTGGG - Intergenic
1148341677 17:46877008-46877030 TTTCAGTCCTGCTGTGCTCTTGG - Intronic
1148471944 17:47899787-47899809 GCTGCGGGCTGATGTGCTCTTGG + Intronic
1150391390 17:64791678-64791700 GCTTTGTCCTCCTCTGATCTGGG + Intergenic
1150461627 17:65358604-65358626 TCTTCCTCCTGCTGTGGCCTTGG - Intergenic
1152148062 17:78581088-78581110 GCTTCCTGCTGCTGATCTCTGGG + Intergenic
1152927319 17:83093245-83093267 GCTTCTACCTCCTGTGCTCCTGG + Intronic
1154053235 18:10983527-10983549 GCTTATTCCTTCAGTGCTCTGGG - Intronic
1155620104 18:27768667-27768689 GCTTCGACCTCCTGGGCTCCAGG + Intergenic
1156548306 18:37987877-37987899 GCTTCTGATTGCTGTGCTCTTGG - Intergenic
1160087186 18:75787257-75787279 GCTTCCTCCAGCTGTGCCCTGGG - Intergenic
1162587343 19:11568337-11568359 ACTTCTTCTTTCTGTGCTCTGGG + Intronic
1163031289 19:14545837-14545859 GCTTCTTCCTGCTGTCCCCGAGG + Intronic
1163483680 19:17573897-17573919 GCTTCGACCTCCTGGGCTCAAGG - Intronic
1163835376 19:19570239-19570261 GCCTCATCCTGCTCTGCTCCTGG + Exonic
1164318108 19:24112966-24112988 GCTTCTTCCTGGTTTACTCTTGG - Intronic
1166469909 19:43071212-43071234 TCTGCTTCCTGCTCTGCTCTGGG - Intronic
1167225933 19:48240271-48240293 GCTTGGTTCTGCTCTGATCTGGG + Intronic
1167263496 19:48471971-48471993 GCTTCGAACTGCTGGGCTCAAGG - Intronic
925174478 2:1772444-1772466 CCCTCGTTCTGGTGTGCTCTGGG - Intergenic
925297809 2:2789817-2789839 GCTCCTGCCAGCTGTGCTCTGGG - Intergenic
927208843 2:20626568-20626590 GATTGATCCTGCTGTTCTCTGGG + Intronic
927499328 2:23571799-23571821 CCTTGGTACTGCTTTGCTCTAGG + Intronic
932400706 2:71479254-71479276 GCTTTGTTCTGCAGTGCCCTGGG - Intronic
934215695 2:90029562-90029584 CCTTCGTCCTGCTATGCCCATGG + Intergenic
940718671 2:157257941-157257963 GCTGCTTCCTGCTGTGTTCAGGG + Exonic
942050110 2:172131887-172131909 GATTACTCCTGCTCTGCTCTTGG - Intergenic
1171241366 20:23569679-23569701 GCCTGGCCCTGCTGTGATCTGGG - Intergenic
1172778235 20:37420398-37420420 GCTTTGTGCTCCTGGGCTCTGGG + Intergenic
1172846498 20:37932581-37932603 GCTTCGTCCCACTGGGCACTTGG - Intronic
1173421586 20:42906092-42906114 GTTTCTGCCTGCTGTGGTCTCGG - Intronic
1174523996 20:51156856-51156878 GCCACTTCCTGCTGTGATCTGGG - Intergenic
1175798158 20:61785301-61785323 GCTTCCTCCTGCTGGGCTGTGGG + Intronic
1178422959 21:32456797-32456819 GCTTTTTGCTGCTGTTCTCTAGG - Intronic
1179022906 21:37656250-37656272 GGTTCTTCCTGCTGTGCTCAGGG + Intronic
1179047115 21:37855959-37855981 CCTGCCTTCTGCTGTGCTCTGGG - Intronic
1183713566 22:39520766-39520788 GGGTCGTCCAGCTGTGCTCCTGG + Exonic
949106293 3:203833-203855 CCTCCATCCTGCTCTGCTCTGGG - Intronic
954891789 3:53937336-53937358 CCTTCGTCCTGCAGTTATCTAGG - Intergenic
957721712 3:84011035-84011057 ACTTCTTCCTGCTATGGTCTTGG - Intergenic
958015860 3:87939578-87939600 ACTTCTTCCTGCTTTGGTCTTGG + Intergenic
960807263 3:121596185-121596207 GCTTTGTCCTACTCTGCCCTTGG + Intronic
961020206 3:123498870-123498892 GCCTCTTCCTTCTGAGCTCTTGG - Intronic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
961363386 3:126382320-126382342 GCTTCCTCCTGGTGTTCTCTTGG - Intergenic
967017622 3:185496351-185496373 GACTCTGCCTGCTGTGCTCTTGG - Intronic
967219154 3:187234732-187234754 ACTGTGTCCTGCTGTGCTTTTGG - Exonic
968313510 3:197703486-197703508 GCTACATCCTGCTGAGCTCCAGG + Intronic
968719856 4:2193727-2193749 GCCACGTCCTGCTTTGCTCCTGG + Intronic
969637222 4:8376465-8376487 GCTTCACCCTGCTGTGTTCTGGG - Intronic
971478208 4:27091599-27091621 GCCTCGACCTTCTGTGCTCAAGG + Intergenic
973727436 4:53790272-53790294 GCTTGGTCATGCTGTACTGTTGG - Intronic
975281684 4:72569159-72569181 ACTTCCCCCTGCTGTGCTCCGGG - Intergenic
975812756 4:78186597-78186619 GCATATTCCTGCTGTGGTCTGGG - Intronic
975860821 4:78674886-78674908 GCCTCGACCTCCTGTGCTCAAGG - Intergenic
980019141 4:127687778-127687800 GCATCGTACTGCTGAGCACTGGG - Exonic
981104273 4:140863009-140863031 GGTTCTTCATGCAGTGCTCTTGG - Exonic
983179752 4:164633877-164633899 ACTTCGTCCTGGTTTGGTCTTGG - Intergenic
983228866 4:165110345-165110367 CCTTCCTCCTCCTCTGCTCTAGG + Intronic
984350265 4:178581434-178581456 TCTTCGTCCTGCATTGTTCTGGG + Intergenic
985209944 4:187581861-187581883 GCCTCGACCTGCTGGGCTCAAGG - Intergenic
985249397 4:188008127-188008149 GCTTCTTCATGCTGTGCGTTAGG + Intergenic
985478351 5:92165-92187 GCCTGGTCCCGCTGTGCACTGGG - Intergenic
985688635 5:1295017-1295039 GCTGCGTCCTGCTGCGCACGTGG - Exonic
992543376 5:77785838-77785860 TCTTCGTCCTGCTGGGCGCCAGG - Intronic
996565674 5:124877774-124877796 GCTTCTTTCTGCTTTTCTCTTGG + Intergenic
1003493425 6:6642984-6643006 GCTTCCTCCCACTTTGCTCTTGG + Intronic
1004703703 6:18103039-18103061 GCCTTCTCCTTCTGTGCTCTTGG - Intergenic
1006333387 6:33407918-33407940 GGTCTGTCCTGCTGTGCGCTTGG + Intronic
1008655910 6:53613879-53613901 GCCTCGACCTGCTGGGCTCAAGG + Intronic
1010677520 6:78761549-78761571 GCTTCTTCCTGGTTTGGTCTTGG - Intergenic
1013053732 6:106562907-106562929 GCTTCGACCTCCTGGGCTCAAGG + Intronic
1015793799 6:136990167-136990189 GCTTCCCTCTGCTCTGCTCTCGG - Intergenic
1016773308 6:147876057-147876079 GCTTCCTCCTCCAGTGTTCTAGG - Intergenic
1017537545 6:155364221-155364243 CCTTCCTCCTGCTGTGCTCGTGG - Intergenic
1017971453 6:159315675-159315697 GCTCCTTCCAGCTGTGCTCCCGG - Intergenic
1019400363 7:848706-848728 GCTGCCTCCTCCTGTGGTCTTGG + Intronic
1019615727 7:1959514-1959536 GGCTTGTCCTGATGTGCTCTGGG - Intronic
1019674898 7:2305061-2305083 GCTCCTTCCTGCTGTGCTGCCGG + Intronic
1020448204 7:8292244-8292266 GCTTCTTGCTGCTGCCCTCTAGG + Intergenic
1022594290 7:31697224-31697246 GCGTTGTCCTGAAGTGCTCTGGG + Intronic
1022701909 7:32769306-32769328 GCTGTGTTCAGCTGTGCTCTGGG - Intergenic
1022906143 7:34859464-34859486 GCTGTGTTCAGCTGTGCTCTGGG - Intronic
1024817926 7:53293321-53293343 GCTACGGCCTGCTGGGATCTGGG + Intergenic
1027693412 7:81376660-81376682 ATTTAGTTCTGCTGTGCTCTTGG + Intergenic
1027775204 7:82456374-82456396 GCTTCAACCTCCTGTGCTCAAGG + Intergenic
1031053505 7:116969559-116969581 ACTTCCTCATACTGTGCTCTTGG + Intronic
1032963556 7:137069364-137069386 GCTCCATCCTGCTGTGCTTCTGG + Intergenic
1034433657 7:151053068-151053090 GCCTCTTCTTGCTGAGCTCTGGG - Intergenic
1034512468 7:151547562-151547584 GCCTCGTCCTCCTGGGCTCAAGG + Intergenic
1034978237 7:155460066-155460088 GCTCACTCCTGCTGTGATCTGGG - Intronic
1035790054 8:2296245-2296267 GCTTCGGCCTGCGGTGCTGTGGG + Intergenic
1035802751 8:2425460-2425482 GCTTCGGCCTGCGGTGCTGTGGG - Intergenic
1036163339 8:6408613-6408635 GCTTCTACCTCCTGGGCTCTAGG + Intronic
1036222752 8:6934394-6934416 GCTTCCTTCTCCTGGGCTCTGGG + Intergenic
1036347444 8:7976644-7976666 GCTTCGTTTTGTTTTGCTCTTGG + Intergenic
1036742750 8:11379736-11379758 GCTTCCTCCTGCTATTCTCGTGG + Intergenic
1036842191 8:12132668-12132690 GCTTCGTTTTGTTTTGCTCTTGG + Intergenic
1036842748 8:12137419-12137441 GCTTCGTTTTGTTTTGCTCTTGG + Exonic
1036864026 8:12378923-12378945 GCTTCGTTTTGTTTTGCTCTTGG + Intergenic
1037920921 8:22804898-22804920 GCTCCTTCCTGCTGTTCCCTCGG + Intronic
1038164047 8:25067708-25067730 GCTTCCTCCTGCTGTGGGGTGGG + Intergenic
1042260844 8:66857698-66857720 GCTTCGACCTCCTGGGCTCAAGG - Intronic
1043476539 8:80611085-80611107 GCTTCTTCCTGCTGTGAGCCTGG - Intergenic
1047966964 8:130052021-130052043 GCTTCCTCTGGCTGTGCTTTCGG - Intergenic
1049411233 8:142474869-142474891 GCTCCGTCAGGCTGTGCCCTGGG + Intronic
1056103274 9:83321514-83321536 GCTTTATTCTGCTGTGGTCTGGG + Intronic
1056251363 9:84751496-84751518 GCTTCGACCTCCTGGGCTCAAGG - Intronic
1057170337 9:92959622-92959644 GCCTCGACCTCCTGTGCTCGAGG - Intronic
1057767000 9:97930061-97930083 GCATCTTCCTGGTGTGCTTTAGG + Exonic
1061505492 9:131029551-131029573 TCTTTGTCCTGCTCTGCTCTTGG - Intronic
1061618405 9:131794916-131794938 GCTTCGTTGTGCTGTGTTCGAGG - Intergenic
1062314301 9:135958534-135958556 GCTTCTCCCTGCTGTGCTCCTGG - Intronic
1062524226 9:136971845-136971867 GCTTTGGCCTGCAGGGCTCTGGG - Exonic
1188564238 X:31507453-31507475 TCTTCTTCCTGCTGTCCTGTAGG - Exonic
1189752612 X:44237872-44237894 CCTTGGTCATGCTCTGCTCTAGG + Intronic
1190338068 X:49274912-49274934 ACTTCTCCCTCCTGTGCTCTGGG + Intronic
1195321927 X:103727718-103727740 GCTCCATCCTGATGTGGTCTTGG + Intronic
1195741711 X:108071611-108071633 TGTTCTTCCTGCTGTGGTCTTGG + Intronic
1199664297 X:150084254-150084276 GCTTTGCCCTGCCTTGCTCTTGG + Intergenic
1201363740 Y:13181794-13181816 GCTTCTTCCTGGTTTACTCTTGG + Intergenic